23/4/17

La parada.

Subió los diez pisos hasta la azotea. Tenía que alejarse rápido de allí. Miró a un lado y a otro. Nada. Entonces levantó la vista como una súplica.. Silbó e hizo aspavientos mientras se acercaba al borde.

- Sáqueme de aquí. – Pidió.

La nube lo acogió y el viento empezó a soplar.

18/4/17

Natillas.

Amor es cuando a los dos os chiflan las natillas y la última termina caducando en el frigorífico esperando que sea el otro quien se la quede.


Bubo dixit.

12/4/17

50 mm

¡Decidido! Este año no me mareo. Nada de llevar dos o tres bolsas con aquello que puede hacer falta por si... y luego termina en la mochila en el mismo lugar que le diste cuando empezaste a hacerla para el viaje. ¡No! Este año voy a tirar de básicos. Para todo, para ropa, accesorios, y sobre todo para la cámara. Ni dobles o triples objetivos, ni dos cámaras, ni filtros, ni flash, ni hostias... Este año toca ir en plan fácil, o díficil según se mire.
Y ¿por qué? Pues porque este año apetece hacer fotos. Llevo varias salidas donde he cogido la cámara y no he realizado ni una fotografía. Un viaje a Sevilla, otro a Guadix y la cámara ha vuelto sin  disparar ni una vez. Esta vez no va a ser así. Pero tampoco tengo ganas de estar en plan reportero. Desde hace unos años los concursos de fotografía han proliferado en Semana Santa, al menos en Priego se han juntado hasta tres, y al personal se le va la pinza. Odio cuando un tipo enarbolando una cámara empieza meterse dentro de la procesión, cuando obliga a los penitentes a esquivarlo, a parar incluso el paso mientras se cree un Kevin Carter. Así que esta vez voy en plan tranquilo. Sin prisas, sin buscar excentricidades y aprovechando lo que dé de si un 50mm. Nada de detalles, a no ser que esté muy cerca, solo generalidades. Viendo las procesiones como hay que verlas, desde fuera. Fotos de recuerdos, de gente, de las de todas la vida, mejores o peores, sin forzar, una y para de contar. Nada de ir de fotógrafo de semana santa que últimamente me toca tanto las narices.
El mundo, al fin y al cabo, lo vemos en 50mm.

8/4/17

Las gafas.

Hablaba con un amigo de lo poco que escribo en los últimos meses cuando un tipo nos interrumpe. 
- ¡Oiga! Tengo yo unas gafas para eso. 
- ¿Como?
- ¡Unas gafas! ¡Para escribir!
Miro al tipo con una mueca escéptica. Pero debe ser un vendedor nato y girando la silla se posiciona entre mi compadre y yo. 
- Si, verá usted. ¿A que su problema es la página en blanco? 
- Pues... - Me niego a admitirlo.
- ¡Es normal! Usted antes miraba a una persona y conocía su historia. Mire a aquella señora. ¿Que ve?
- Pues a una mujer. 
- Pero usted antes no veía solo a una mujer. Usted veía historias. Miraba a la señora y podía contar como fue su noche de bodas, la pelea con aquel novio cuando vino de la mili, como lloró en el funeral de su padre. Usted no veía una mujer, antes veía todas las historias que esa mujer tenía tras de si, todas las que podían sucederle, no solo su vida si no todas las vidas que llevaba arrastrando y las que aún pululaban por su alrededor. Y recuperar eso es lo que yo le ofrezco con las gafas. 
Me quedo mirando al tipo como si me hubiese diagnosticado un cáncer y me pusiese en la mano una pastilla para curarlo. Después miro a mi primer interlocutor. Que sigue mirándolo incrédulo. A él no le gusta escribir, no tiene el cáncer. Ni si quiera me deja preguntarle.
- Aquí las tiene. - Me dice sacando unas gafas de sol viejas en una bolsa de plástico.- Son suyas por cien euros. Esto es mejor que cualquier curso que quiera hacer sobre escritura. 
- ¡Cien euros! Solo tengo... ¡Miguel déjame veinte euros! -Le pido a mi amigo mientras miro la cartera.
- ¿Pero que dices tío? ¿Tú estás loco? ¿Le vas a hacer caso a este tio?
- ¡Por tus muerto Miguel! Déjame los cuarenta euros. 
- Pero tío que me dejas sin pelas. Que no vamos a tener ni para pagar estas birras.
- ¡Mira Miguel...! Vete a la mierda y déjame los cuarenta euros. 
Miguel se levanta de la silla mirando al tipo de las gafas, saca el dinero y lo tira en la mesa. Sale apresurado del bar. Yo dejo el resto encima de los dos billetes de veinte y el tipo me alarga las gafas con una sonrisa encantadora. Recoge su dinero y se despide. 

Abro la bolsita de plástico que tiene las gafas. Hace años tuve unas parecidas. Las miro con miedo, están ralladas, cierro los ojos y me las coloco. Cuando los abro giro la cabeza hacia el espejo del bar, lo primero que veo es mi imagen. 

30/3/17

Nada.

Sigo siendo el mismo hombre que te hacía reír en el bar. Sigo siendo el mismo tipo que un día te vio feliz. Sigo siendo aquel chaval que andaba a tu lado con los libros en bandolera. Que recogía tu sonrisa con clips de colores, que te manchaba las mejillas de tinta cuando te pellizcaba tus oyuelos. Sigo siendo aquel niño que te quitaba caramelos de regaliz. Sigo siendo, pero sin ti... Sin ti no soy nada. 

29/3/17

Arturo Andrade.

Miró los libros que le rodeaban. Ahora no sabía si le acompañan o le cercaban. 

De El arte de matar dragones.
Ignacio del Valle.

21/3/17

Día de la poesía.

A algunos, (O sea, a mi.)
es decir, no a todos. (Por que el resto me da igual)
Ni siquiera a los más, sino a los menos. (Aunque alguno que otro te sorprenda)
Sin contar las escuelas, donde es obligatoria, (y algún hijodeputa te hace aborrecerla)
y a los mismos poetas, (o peor, a los que se creen "poetas")
serán dos de cada mil personas. (deberíamos añadir la música y quizá subiese el número)

Les gusta, (Me gusta.)
como también les gusta la sopa de fideos, (Odio la sopa de fideos, pero me encantan el salmorejo)
como les gustan los cumplidos y el color azul, (y besar a los que queremos)
como les gusta la vieja bufanda, (o unos vaqueros gastados)
como les gusta salirse con la suya, (o una discusión)
como les gusta acariciar al perro. (mirar las minifaldas de primavera.)

La poesía,
pero qué es la poesía. (Olvidate de Bécquer.)
Más de una insegura respuesta
se ha dado a esta pregunta. (Y para gustos los colores.)
Y yo no sé, y sigo sin saber, y a esto me aferro
como a un oportuno pasamanos. (Como a su pecho en la noche.)

De Wislawa Szymborska con comentarios hechos a "voleo".

¡Feliz día de la poesía!

14/3/17

de gente que no sabe lo quiere.

Miénteme, le pidio. Y ella lo hizo. Todo iba bien pero un día las mentiras se descubrieron y él no pudo aguantar esa traición.

3/3/17

Clarividencia.

Trescientos sesenta y tres periódicos al año, trescientos sesenta y cuatro los bisiestos y sigue sin entender la estupidez humana pero hoy la clarividencia le ha llegado de pronto. Arruga el diario y lo arroja a la basura. Cambia la radio de noticias por música. 

Y se convierte en un estúpido feliz. 

1/3/17

Borges y yo.

Al otro, a Borges, es a quien le ocurren las cosas. Yo camino por Buenos Aires y me demoro, acaso ya mecánicamente, para mirar el arco de un zaguán y la puerta cancel; de Borges tengo noticias por el correo y veo su nombre en una terna de profesores o en un diccionario biográfico. Me gustan los relojes de arena, los mapas, la tipografía del siglo XVIII, las etimologías, el sabor del café y la prosa de Stevenson; el otro comparte esas preferencias, pero de un modo vanidoso que las convierte en atributos de un actor. Sería exagerado afirmar que nuestra relación es hostil; yo vivo, yo me dejo vivir, para que Borges pueda tramar su literatura y esa literatura me justifica.
Nada me cuesta confesar que ha logrado ciertas páginas válidas, pero esas páginas no me pueden salvar, quizá porque lo bueno ya no es de nadie, ni siquiera del otro, sino del lenguaje o la tradición. Por lo demás, yo estoy destinado a perderme, definitivamente, y sólo algún instante de mí podrá sobrevivir en el otro. Poco a poco voy cediéndole todo, aunque me consta su perversa costumbre de falsear y magnificar. Spinoza entendió que todas las cosas quieren perseverar en su ser; la piedra eternamente quiere ser piedra y el tigre un tigre. Yo he de quedar en Borges, no en mí (si es que alguien soy), pero me reconozco menos en sus libros que en muchos otros o que en el laborioso rasgueo de una guitarra. Hace años yo traté de librarme de él y pase de las mitologías del arrabal a los juegos con el tiempo y con el infinito, pero esos juegos son de Borges ahora y tendré que idear otras cosas. Así mi vida es una fuga y todo lo pierdo y todo es del olvido, o del otro.
No sé cuál de los dos escribe esta página.

Jorge Luis Borges. 

Todo un hallazgo este texto. 

28/2/17

La La Land

Los musicales son como el porno. Sin venir a cuento se ponen a cantar, a bailar o a follar. Lo importante no es la historia si no el movimiento y ruido que hacen en esos intervalos de la narración.

Bubo dixit. 




Por cierto, curioso que La La Land tenga un título que sugiere el chiste ese del cunnilingus con la canción de Massiel. 

21/2/17

Matar a besos.

La cogió desprevenida y le plantó un beso en el cuello mientras con la abrazaba fuertemente. Tan fuerte era el cariño que los ojos se le salieron de las órbitas, tan fuerte que las costillas le saltaron, un cariño tan fuerte que cuando la vio desfallecer le plantó otro beso y la dejó caer en el suelo. 

19/2/17

5 discos.

Al final del año pasado tenía la idea de escribir varios post con listas de cinco contenidos. Creo que conseguí terminar alguna, la de las series y la de los tweets. Por ahí se me quedó pendiente una de canciones identificativas de parejas, otra de libros, otra de fotos y una de discos. La de discos llegué a terminarla. Fui capaz de identificar cinco discos que han sido importantes. Aunque ahora, una vez que he vuelto a ver la lista, no se si la hice pensando en el disco entero, o sea, todas las canciones, o solo en la importancia que tuvo en esa época ese dísco. Además me faltan, y no, no he puesto solo discos en español, es que para mi son los mas importantes. Que sí, que habrá discos que son las hostia y seguramente en esta lista debería estar Money for Nothing pero terminó cayendose de la lista así que... Esto se queda así:

 - Tren de Medianoche. Con este disco descubrí a La Frontera, así que tiene que entrar. Quizá no sea el mejor pero para mi es imprescindible. Rock y Country a partes iguales. Borrachos de salón y canciones desesperadas. Descubrir este disco con quince años es una de las cosas que mejor te pueden pasar. Canciones como "El Rey de la noche" hacen que la autoestima suba muchos enteros, o "Todo cambiará mañana" que al final viene a ser un canto de esperanza cuando es lo único que queda. Echarse a morir y ya vendrán las cosas de otra manera cuando salga el sol. Y por su puesto una de mis debilidades fronterizas: "Siempre hay algo que celebrar" que es mejor que el himno de la Alegría o cualquier canción de Diego Torres para subir el ánimo. 


 - A por ellos que son pocos y cobardes. Ni Pérez-Reverte volvío a escribir igual después de "El Club Dúmas" ni Loquillo volvió a cantar igual después de aquel año del 88 en que grabó el directo en la Sala Zeleste. Lo mejor de Loquillo, de los Trogloditos y de Sabino Mendez, aunque ya no esté en el directo, está en este disco. Aquellos jovenes rebeldes que decidieron hacerse mayor en la sala y antes nos dejaron un disco doble antológico. Loquillo, con su chulería, y su elegancia nos ha enseñado a crecer a los que vamos una generación por debajo. Quizá no entendimos bien su disco de diez años después "Nueve tragos" pero solo era cuestión de tiempo. De llegar a sus años, y por su puesto sin había alguna duda al años siguiente con "Cuero Español" y sus "Cuando fuimos los mejores". José María Sanz Beltrán se convirtió con este disco en el hermano mayor que nos fue marcando el camino. Y sigue haciéndolo. 

 - Hotel dulce hotel. Si bien este disco se publicó a la misma vez que "Tren de medianoche" (1987) a mi me llegó mas tarde. Al menos dos o tres años después. Principios de los noventa. o quizá finales del 89. Este fue mi primer disco,  completo, de Sabina. Lo había escuchado en la Mandrágora, infinidad de veces en el casette del coche aquellas "Malas compañías" que resultan ser las mejores, alguna de Viceversa pero este fue el que me llevó a buscar aquellas cantautores que escuchaba mi hermana, a descubrir a Silvio, a Leonard, a Jara, a no hacerle ascos después a gente que no necesitaba una guitarra eléctrica para ponerte los vellos de punta. A valorar las letras y descubrir que hay poesía entre la música. Hotel, dulce hotel, fue el primero pero después han llegado muchos mas. Y así paso incluso de década. 

 - Cosas mías. Este disco fue una apuesta. Una de las mejores que he hecho. Creo que es uno de los discos mas completos que hay en mi casa. ¡Ni una! Ni una canción la considero mediocre. Antonio Flores, con pinto de indio, de nonaino de pro, se marca un disco espectacular de los que conocía una o dos canciones y me deja con ganas de mas. Con ganas de mas Antonio, de Rosario, de buscar de nuevo a Ketama, de cantautores. Con ganas de esas letras que hablan de mucho mas de lo que cuentan. Como meter en una disco una canción de amor, de desamor, como un gitano le canta a un gay, a su hija. Antonio Flores es puro sentimiento en este disco y a mi me engachó aunque solo conociese de él su "Gran Vía". (Esa canción que siempre canto en Granada en vez de hacerlo en Madrid)

 - Isla mujeres. Compré este albúm porque tenía la canción de una serie que me encanta: "Raquel busca su sitio". Después de poner la canción de Raquel había que seguir escuchando el resto. El disco coincidió con una etapa de cambios importantes. (Se publicó en el 2000.) Me había casado, estaba a punto de tener un hijo, me había metido en una hipoteca y trabajar se hacía de manera constante. He vuelto a escuchar a David Broza en otros discos pero no llega a ser alguien me me disloque, sin embargo este disco se ha colado como uno de los esenciales en mi vida. Desde hace dieciseis años hay una canción que silbo constantenmente, puede que esté varios días sin hacerlo, alguna semana incluso pero todos el que me conoce bien me ha escuhado silvar "Carmela" que es casi como un himno. Curioso que después del divorcio: "Navegando solo" sea otra de las canciones que mas silvo y también pertenece a este disco.  ¡Si! Sin lugar a dudas se merece estar en esta lista. 

Me faltan discos, me falta música, mucha música. Me faltan los discos que me han dado tanta vida estos últimos años, Fito, MClan, Norah Jones, Dire Straits, Stray Cats, Marea o Ismael Serrano... ¡Vete tú a saber! Incluso el alegrón de esta mañana con Andrea Motis pero... esos irán a otra lista. La de hoy se queda como está. Si no los has escuchado... Prueba a busca en Spotify. Espero que entren en tu vida tan bien como en la mía. 


14/2/17

San Valentín.

Que, al parecer, la discusión no es por regalarle una caja de bombones cuando me ha dicho varias veces que está a dieta. Que el problemón viene por haber dicho:
- ¿Siii? Pero si estas igual.

Guau!

¡Empezó él! 
Yo paseaba de camino a casa. Andaba despacio, sin prisa por llegar. Eran las una y media de la mañana y ya había terminado mi jornada en el curro. Era el momento de saborear un cigarro, de escoger música en el Ipod sin estridencias. Un poquito de jazz que le he vuelto a coger el gusto después de ver La La Land. El mundo, en esos momentos, es ese lugar mágico al que aspiramos llegar cuando nos jubilemos. Y lo estaba disfrutando hasta que sin previo aviso:
- ¡GUAUGUAUGUAUGUAUGUAU!
El corazón empezó a bombear a un ritmo frenético, los pulmones se llenaron de humo, el retemblido de mi cuerpo hizo que diese un tirón a los auriculares que salieron volando y casi se llevan media oreja. Dos segundos mas tarde, cuando me empezaba a recuperar, pude verlo. Un boxer color canela seguía ladrando con las patas en alto junto a una reja. Los dientes y la boca babeando mientras yo miraba a uno y otro lado casi como si quisiera disculparme de la enajenación canina por tanto ruido. 
Seguí mi camino pero el agradable paseo había terminado en una revolución en mi organismo para encontrar la paz. Imposible hasta que llegué a casa.
Fue la primera vez. El día siguiente al pasar cerca de la casa donde se encontraba el perro iba preparado. Ni idea de donde estaba, no lo ví y tampoco lo busqué esperando en la reja por si lo encontraba. Segui mi camino. Pero al día siguiente, de nuevo con un andar pausado, y unas bolsas del supermercado el boxer volvió a darme uno de esos sustos que me dejaban el corazón en la otra acera. Lo peor no era el susto, que también, era la sensación de imbécil que se me quedaba. Por que cada susto iba seguido de un salto y una contracción del cuerpo que me hacía parecer una niña histérica y asustada. Las manos en el cara, la pierna mas cercana a la reja encogida en la cadera mientras la otra temblaba. Una situacion vergonzosa que, si bien no veía casi nadie, a mi me daba la sensación de que toda la calle se descojonaba a mi costa. Incluido el perro que tenía esa pinta de Lindo Pulgoso cuando rie.
Dos semanas me ha tenido el perro en vilo. Unos días lo esperaba y ya no acojonaba tanto, otros volvia a olvidarlo y volvía a parecer esa niña asustada. ¡Vergonzoso! 
Pero ya ha llegado. ¿Sabes esos silbatos que son de ultrasonidos para los perros? Me he hecho con uno. Ahora cada vez que estoy cerca de la casa lanzo un silbido, que no oye nadie y el boxer comienza a ladrar como si le fuese la vida en ello. Tengo que reconocer un pequeño placer cuando entro temprano a trabajar. Y a las cuatro y media de la madrugada paso con la bici, o andando y suelto un pitonazo inaudible para todos. Para todos menos para mi amigo que revoluciona a todo el barrio a horas intempestivas. Creo que dos turnos mas de trabajo en horas tempranas harán que deje de ladrar durante mucho tiempo. A mi me encantan los animales, tanto, que no puedo tenerlos secuestrados en casa. Quizá el pobre no tenga la culpa pero desde luego... ¡Yo no empecé!

12/2/17

Amarga

Amarga como la bilis
de una borrachera en lunes.
Como la hostia de tu padre
cuando los huevos son negros.
Como el primer beso
que te negó aquella gorda.
Amarga como las heridas
del vacileo.
Como el trabajo
que no te dieron.
Igual que el licor de almendra
para impresionar a una idiota.
Amarga como todas las despedidas
como la última, como la primera.
Amarga porque ella ya no es dulce.

9/2/17

La instalación.




(Para @FeoMontes,
que me dio un tirón de orejas el otro día 
y ya tocaba un relato en este plan.)



Busco al camarero para pedir la tercera cerveza. Mi hermana se levanta de la mesa y llama a una tía que acaba de salir de un coche mal aparcado.
- Marga - Grita.
La tal Marga se acerca con prisa. Le da dos besos. Yo me levanto, me presenta, y le doy otros dos.
- ¿Que haces aquí? Pensaba que hoy no venías a recoger a Jaime.
A Marga se le abren los ojos. Le cambia la cara.
- ¡Hostia! Es verdad. Hoy lo recogía Nicolás. ¡Me cago en...
- Bueno... ya que estás aquí... ¿Te tomas algo?
- ¡Joooder! - Exclama Marga.
El camarero se presenta. Pido mi tercera cerveza, mi hermana otra caña y Marga, después de dudar un rato, se pide un tercio de Heineken. Se sienta con nosotros. Nos comenta el día tan estresante que lleva. Mira su coche varias veces.
- No te preocupes. - Le digo - El coche que bloqueas es el mío.
Marga le da un trago generoso a su tercio dejándolo en poco mas de la mitad. Suena el timbre del colegio.
- ¡Hostia! - Mi hermana se levanta de la mesa. - Me voy, que ya están saliendo los niños.
Nos deja a Marga y a mi en la mesa mientras el camarero trae tres tapas. Se las ofrezco a Marga. Que sigue hablando de su trabajo y del despiste que tiene en los últimos días. Por fin se ha mudado a un piso mas pequeño. Aún tiene las cosas por medio y ya que no va a tener a Jaime hasta mañana aprovechará para colocar las cosas.
- Lo peor es el ordenador. - Me dice - Necesito conectarlo a la televisión y a los altavoces y odio tanto cable suelto.
Me ofrezco a ayudarla si me invita a otra cerveza mientras lo conecto. Marga acepta. La casa está cerca y los dos nos montamos en su coche. Piso un peluche y ella se inclina para cogerlo y tirarlo sin miramientos a la parte de atrás. Ver su cabeza entre mis piernas me he excitado. Ella sale con el coche sin mirar el retrovisor. Un tipo nos saluda con un pitonazo. Marga levanta el brazo. No distingo si es una disculpa o un aspaviento.
 Su casa es como su coche. Todo está patas arriba. Entra y recoge una camiseta, algún juguete suelto y mientras me dice que me siente la veo huir por el pasillo. Cuando vuelve ya no trae la cazadora de cuero. El jersey se le queda pegado a su talle. Tiene buenas tetas y tardo en darme cuenta que las miro mas de lo que la elegancia permite. Ella me sonríe. Me señala la televisión, un ordenador portátil con varios años y un equipo de música y un amasijo de cables que es imposible distinguir cual es cual. Vuelve a perderse mientras voy curioseando el equipo y  regresa con dos Heineken. Se sienta en el brazo del sofá, está tan cerca que puedo oler su pelo. Deja una de las cervezas en la mesa y a la otra le da un buen sorbo. Sus tetas se le marcan cuando levanta la cerveza. Gira el cuello y se duele. Me esta poniendo nervioso con tanta actividad.
- Marga, siéntate y te tomas la birra tranquila. Esto es solo un momento.
Empiezo a organizar el cableado y ella se sienta en el sillón. Vuelve a darle un sorbo a la cerveza que la deja tirando. Se levanta. Se acerca de nuevo y me trae la que ha dejado en la mesa. Le doy un sorbo y se la vuelvo a entregar. Ella le da otro trago. Verla desde el suelo es aún mas impresionante. Se pega y mira como voy conectando los cables.
- ¿Ves? ¡Es fácil! Aquí tienes que conectar estos y este último a la televisión.
Y entonces me levanto haciendo que Marga derrame mi cerveza en la camisa.
- ¡Dios! Encima te pongo perdido. Anda quita y te limpio esto antes de que quede mancha.
. ¡No! Si no...
Pero Marga ya me está desabrochando los primeros botones. Es entonces cuando me doy cuenta de lo que está haciendo. Con la camisa desabrochada le cojo las manos, está tan cerca. Y me lanzo a su boca. Marga se sorprende, solo un segundo, como si la hubiesen pillado en falta pero después es ella la que se lanza buscando la mía. Nuestras manos empiezan a bailar por el cuerpo del otro, la ropa va desapareciendo, la camisa, su jersey, un zapato vuela por el salón,  mientras seguimos como ciegos furiosos tanteando la piel. Paramos un segundo para coger aire, para reconocernos y ser conscientes de lo que hacemos y con quien. Solo un segundo. Yo la vuelvo a besar, ahora mas pausado, y empiezo a buscar su cuello. Sus pechos. Voy bajando con mis labios por su costado, y me sitúo de rodillas con los ojos en su ombligo, allí meto la lengua. Marga se contrae, tiene cosquillas. Mis manos desabrochan un cinturón y empiezo a bajar sus vaqueros. Tiene unas bragas de cuadros rojos, casi infantiles. ella sonríe, y susurra algo así como: si lo llego a saber. Mis dientes muerden la tira de arriba mientras mi lengua juega con los cuadros. Sus vaqueros, con mas apuros de los previstos, terminan en el suelo. Ella me coge de la cabeza mientras sigo jugando con la tela de sus bragas cuando mis manos se disponen a retirarla ella me gira la cabeza para que la mire. Me obliga a levantarme. Vuelve a besarme. y ahora es ella la que juega en mi cuello. De un empujón me tira en el sofá. Su lengua se entretiene en uno de mis pezones. Mientras sus manos desabrochan el cinturón. De un tirón desabrocha tres botones de los Levi´s. Empieza a retirar el vaquero y doy un respingo en el asiento para facilitarle la labor. Los vaqueros siempre son un engorro para el sexo rápido, Los zapatos se interponen pero ella los quita con facilidad. Se incorpora y tira de los perniles, me quedo con un boxer de lunares. Disfruto mirándola y se recrea mientras ser quita las bragas. Les estaba cogiendo cariño pero me excito mas si cabe cuando veo que está totalmente depilada. Su sexo se muestra sin pudor y me adelanto para saborearlo plenamente. Marga ya está mojada y me lengua disfruta jugando con sus labios. Me coge la cabeza, me aprisiona entre sus muslos y durante unos segundos casi no puedo respirar. Entonces me empuja. Coloca mis piernas entre las suyas y se pega a mi cuerpo. Con su mano derecha coge mi polla y juega unos segundos con ella antes de introducirla suavemente en su
coño. La primera embestida es dulce, la segunda hace que sea un acople perfecto, la tercera, la cuarta, la quinta, la sexta, son rápidas y ágiles. Le agarro el culo para marcar un ritmo mas lento. y ella me retira las manos, me las coloca sobre la cabeza y sigue con sus embestidas. Sus tetas están a la altura de mi boca y busco un pezón. Lo chupo, Ella sigue con mis manos cogidas y un ritmo frenético. Va a conseguir que me corra en momentos. ¡No! No puedo permitirlo, Me está gustando mucho. Con un esfuerzo recupero mis manos y agarrándola de la cintura la tumbo en el sofá. Ahora soy yo quien marca el ritmo. Mi polla baila en la puerta de su sexo. Me sonríe. Con la punta le acaricio el clítoris. Me recupero pero ella me coge el culo y lo aprieta contra sus piernas. Otra vez dentro. Me marco un ritmo lento. Entro y salgo de ella con la facilidad que da estar lubricados. Me coloca sus piernas encima de mis hombros, entonces la penetro con fuerza. Vuelve a marcarme el ritmo con sus manos en mis nalgas. Una embestida, otra, otra. Su cara se contrae y una mueca refleja su orgasmo. Sigo embistiendo y cuando estoy a punto de correrme es ella la que separa sus piernas y se separa. Me coge la polla fuerte con la mano izquierda y me levanta del sofá. Tira de mi hacía la mesa. Como si fuese un perrillo faldero la sigo. Se tumba en la mesa. Me ofrece su coño de nuevo. La misma facilidad para volver a entrar dentro de ella. Mis manos van a sus tetas. Mientras sigo empujando, la mesa y Marga gimen a la vez. Mi aguante no llega a mas. Saco la polla de su coño y me derramo entre sus muslos. Marga sonríe. Me mete un dedo en la boca. Me mira y me pregunta...
-  Una ducha?



23/1/17

Córdoba.

Uno puede ir a una ciudad y enamorarse en ella.

Lo jodido es cuando de quien te enamoras es de la ciudad. Entonces estás perdido. (Y encima contento.)



Bubo Dixit.

19/1/17

El diario.

- Mátame. – Le pide.
Ya no recuerda cuantas veces lo ha escuchado. Pero de nuevo su esposa es consciente de que la vida no está con ella. Que no quiere seguir sin reconocer a sus hijos, que no quiere comer sin necesidad de que alguien le recuerde que debe hacerlo, que no quiere vivir. Lo mira suplicante y entonces él accede. La coge de las manos y cierra los ojos.
- ¿Cómo se atreve? – Le dice ella seria, mientras le retira la mano.
Y entonces se da cuenta que ya no está con él. Que vuelve a verlo como un desconocido. Antes de acurrucarse en el sillón y mirarlo con desconfianza. Se levanta y a duras penas consigue asearla. La viste con el traje que llevó en la boda de su hijo pequeño. El que tanto se parece a él y ella suele regañarle como si fuese un pequeño en vez del ingeniero que vive en Orense. Ese que tiene tan poco tiempo.
Tantas pastillas en el botiquín. Tantas que por fin, por una vez, van a servir para algo. Brinda con ella con una copa de vino mientras va tragando dos pastillas cada vez. Ella no recuerda porque brindan y empieza a tener sueño. Otro brindis, otra tanda.
- A su salud- Le dice ella. – Es usted muy simpático.
El sueño le vence pero aún quedan pastillas, y él le pide que se las tome. Ella accede.
- La última papa. Ya no quiero mas. – Le pide.
Y entonces, con una lagrima resbalando por sus mejillas, le dice que si, que es la última. Que puede dormir tranquila. Ella se recuesta. Él la acomoda y le deja el vestido arreglado. Sale de la habitación cerrando la puerta. Se sienta en el salón. Comienza a escribir. Rompe el papel. Retoma otro. Llora desconsolado. Cuando deja la carta encima de la mesa. A sus hijos, escribe en sobre.
Recuerda aquella cuerda de compró uno de su hijos para hacer montañismo y va a buscarla. De algo va a servirle aquellos años en el cuartel de El Ferrol. El nudo le sale perfecto. Lo deja colocado junto a una silla. Antes vuelve a la habitación y la besa. Ella no le responde.






18/1/17

No es lo que parece.

Las cosas no siempre son lo que parecen. Aunque otras veces si, si son lo que parecen. Solo que nos gusta verlas distintas. Nos gusta pensar que no nos hemos equivocado otra vez y que lo que vemos, lo que nos hace sentir eso es tan grande, tan fuerte, que no puede sentarnos mal. Y empezamos a disfrutarlo desde el principio. ¡Joder es tan genial que parece mentira! Y lo es. Es mentira. Pero no queremos verlo. Y así nos va. Que vemos lo maravilloso. Si algo no nos cuadra hacemos como lo mismo que cuando cae un pizco de patata al suelo limpio, patada y termina debajo del mueble bar. No queremos ver ninguna imperfección en lo perfecto. Después te das cuenta que, de vez en cuando, hay que barrer debajo del mueble, que lo que se ha ido acumulando hay que recogerlo, quizá ese no era el momento adecuado, y dejarlo limpio para que se vaya ensuciando de nuevo. 
Las cosas no siempre son lo que parecen. Y aunque lo parezcan, no siempre lo son. Las cosas son como las vemos. Y a veces con suerte las vemos siempre bien, y otras... otras podemos verlas como lo que son imperfecciones que hay que cuidar, que mantener para que estén bien, para que sigan en nuestras vidas por mucho tiempo, Mantenerlas, cuidarlas, y mimarlas si es necesario. No tener en cuenta lo malo y si se tiene hacer una limpieza pero seguir con ellas. 

Pero claro... también te puedes dar una vuelta por "los chinos" y comprar barato lo que quieras. Te puede parecer la hostia en verso, pero desde ya te digo que lo que compres no es lo que parece. A no ser que lo que quieras sea un juguete para un rato. 

Y toda esta parrafada a que viene? Pues eso, a que las cosas no son lo que parecen pero otras si, Y por mucho que quieras mantener un capricho que te diste en los chinos no te puede durar toda la vida. Ya sabías que era prácticamente imposible. 

17/1/17

Hambre.

(La otra versión de "Desvestida para tu fiesta". De Juana la Loca.)


Le gusta provocarme.
La miro de reojo mientras se desnuda. Ella lo sabe
y lo hace lentamente. Como si fuese un premio
que se da. (Que me da.)
Se quita las medias dibujando
lineas en sus muslos, flechas que me indican
el camino a seguir. Las baja como caen
los párpados de sus ojos cuando come helado.
Sin prisas, Con toda la lujuria en las yemas.
Aguanto la respiración, jugando a que no me importa
pero cuando su sujetador cae...
y sus pechos bambolean libres...
es imposible mantener la cordura,
ni la respiración, ni los ojos disimulados
y clavo mi mirada en ellos.
Le gusta provocarme.
Le gusta jugar y los masajea
como si le diese gracias a Dios
por lo grandes que los hizo,
por la liberación que siente ahora,
por que sabe que son mi objeto de deseo.
La lengua me recorre el labio inferior,
lo saboreo
como si fuese uno de sus pezones,
igual que un dulce para un diabético.
Fruta prohibida, deseada, tan cerca.
Ella me sonríe y sigue su juego,
sus dedos viajan a la única prenda que oculta
su piel. Entre los muslos se esconden y la retiran
bailando antes de caer entre sus pies.
Se muestra libre
y la miro con todo el deseo que llevo guardado
desde la última vez.
Es mi cena
y tengo hambre.
Mucha hambre.

Hace frío.


Hace frío. Intento engancharme diciendo que en Córdoba no hay la temperaturas de Polonia. Que con un grado no te congelas. Solo es necesario usar camiseta interior, tan poco habitual en mi, o incluso algún jersey de lana. Dejar las camisas de entretiempo y coger, para variar, alguna con algo mas de empaque. Quizá, todo esto, es solo una manera de negarme a que el invierno está aquí. A no querer ver que el frío, el puto enero, está anclado en la casa, en las calles, en mi vida. 
Hace frío. Pero aún puedo aguantar unos días mas. Y no voy a reconocer que está haciendo mella en mi. Hace frío. Pero hay botellas de anis, de brandy, que suben la temperatura. Y también... fotografías estivales que se refugian en la esquinas caldeando, aunque sea por unos minutos el ambiente. 


P.D. La fotografía es de este verano. Turistas entrando en la Mezquita. Un taller de escritura que me obligaba a pasar todos los días por el patio de los naranjos a las cinco de la tarde. Ni uno solo, con cuarenta grados a la sombra, hizo que maldijese el verano. ¡Bendito mes de Septiembre!



15/1/17

...

Necesito que las personas vengan con libro de instrucciones. En caso contrario que no se admitan quejas de un uso acorde a las reglas preestablecidas en la sociedad. Si aún así no es acertado una simple indicación también es bien recibida para modificar el comportamiento. 
Lo que no tolero es que vengan pidiendo el libro de reclamaciones después de pasar la garantía. Ahora solo queda arreglar el desaguisado por tu cuenta o comprar uno nuevo. 

8/1/17

Frustraciones pasadas. (Y presentes.)

Cambio la agenda de un año para otro. Escribir todos los contactos que hay me lleva una tarde entera. Pero la nueva agenda no trae ese listado que aparece siemrpre al final de la A a la Z, Ese donde la página de la Q se queda en blanco y la X e Y la acompañan con mas tonterías que personas conocidas. (Solo conozco a los Yébenes y a esos los tengo como Aguilera.) El caso es que en la agenda hay algunas frustraciones que empezaron como proyecto y no llegaron a cuajar. La falta de tiempo, mi excusa favorita, la desidia, y sobre todo una apatía generalizad en el 2016 lo han hecho posible. Hoy para mortificarme en mi incompetencia voy a publicarlas en esta entrada. (Quizá esto sea un espolón para acabarlas de una puta vez, o simplemente para ratificar mi desidia y dejarlas pasar para siempre.)

1.- Proyecto Miradores: Se basa en fotografiar Córdoba desde los miradores que tiene. La Asomadilla, la torre de la Mezquita (perdón: Catedral), el Mirador del Brillante, el Hotel Palace, la terraza de la Casa árabe... y alguno que otro que debería descubir en esta ruta. Resulta que tengo fotografías casi de todos pero en distintos año, en distintas estaciones y la idea era hacer una en un mes completo. Ahí está... en pendiente. 

2.- A4 cartulina. Manchas: Esta frustración viene de hace muchos años. En los últimos me la ha "potenciado" Angela con sus fotografías y post en los que Pere ha realizado una exposición que me gusta mucho. Desde hace años en los que con café y A5 realicé un mapa del tesoro para mi nene me ha gustado manchar el papel en blanco. Café, Tinto, Cerveza, Fruta... manchas que son las que dan vida al papel. De momento... solo tengo una con café. Un redondel oscuro detrás de una fotografía en el salón. 

3.- Premio EuroStar: Hace cuatro años seleccionaron y premiaron una fotografía del premio EuroStar hoteles. Desde entonces vuelven a enviarme todos los años información para participar y, aunque lo intento, no lo consigo. Con este premio me pasa lo mismo que con el "Caminos de hierro" de Renfe o el de "Relatos de Alsa". Nunca he participado en ellos pero son de hace tantos años que ya no me lo planteo. Aunque sigo fotografiando vías de tren y pensando en ese premio y haciendo relatos de autobuses con la idea de enviarlos a Alsa (alguno de esos me lo premiaron los del Consorico de Transportes.) El premio Mezquita de Fotografía, el de novela corta de Diputación, el de Vicente Nuñez, el de... 

4.-Ir a Bilbao: Desde que abrió la linea Córdoba - Bilbao le tengo ganas. Ya lleva tres años y no hay manera de que algún día me decida a coger el coche de última hora, este en Bilbao 24 horas y vuelva a la noche siguiente. 

5.- Dejar de corregir e imprimir: Cada día hay mas morralla en el disco duro. Muchos microrelatos, relatos e incluso algún amago de novela. Todo esto no deja de ser una mierda y siempre pienso en dejar de escribir, corregir y lo mas importante: imprimir y decidirme a enviarlo por si a alguien le interesa. Esto es una frustración presente, pasada y, casi seguro, futura. 

6.- Olvidar el teléfono de mucha gente: Cosa que hoy por hoy es casi imposible. Aunque el tiempo que dedico a cambiarlos de agenda, este año, lo he dedicado a otra cosa. 


Hay mas frustraciones, seguro. Pero estas son las que tenía en la agenda del 2016. 

Cambiar de agenda, 
es cambiar las frustraciones pasadas 
por presentes. 

5/1/17

Gaspar.

Hace años que me desilusionaron diciendo que eran los padres. Ahora soy yo quien soy rey y padre y coloco los regalos bajo el árbol. Supongo que fue imposible, que solo fue una ilusión, por su puesto en una conversación lo negaría tajantemente pero hoy... hoy aún podría jurar que aquellas Navidades en que cumplí seis años yo vi a al rey Gaspar entrar en mi habitación y sonreírme.