26/7/17

Días de Infancia.

¡Que hermoso es todo! ¡Hay que ver lo bonita que puede ser la vida cuando se sabe disfrutar de ella! ¡Que cosa mas maravillosa es la felicidad!

La abuela de Alexei Peskov
en Días de infancia.
Máximo Gorki.

25/7/17

Lo mejor que tienes.

Lo mejor que tienes no son tus piernas, ni tu cabello... Lo mejor que tienes es mi imaginación.

De Historias del Savoy. 
Jose Luis Alvite. 



20/7/17

Desasosigo.

Desasosiego: 
   Inquietud, intranquilidad. Falta de sosiego. 


Estoy tumbado en la cama, intentando conciliar un sueño que, como diría Fito, viene y va. La respiración empieza a ser profunda, algún amago de ronquido incluso que ya me ha puesto en guardia pero controlo el sobresalto inicial para que llegue ese sueño. Lo estoy consiguiendo. Todas las partes del cuerpo están laxas, estoy entrando en el sueño, profundo, placentero, oscuro, como un tunel como un abismo, una caida eterna. ¡Tunel! ¡Abismo! ¡Caida eterna! Despierto sobresaltado. No es la primera vez. En los últimos días, relativamente tranquilos, me cuesta encontrar una paz completa. Como si algo estuviese esperando nada mas que despistarme para caer sobre mí. Algo que no controlo, algo que ni si quiera tiene que darme miedo. Pienso en el trabajo, en la familia, en la gente que quiero, nada parece que esté mal, nadie peor que otras veces. Quizá exagero porque la cafetera se rompió ayer. Aunque no importa porque hay otra en casa. El frigorífico que me ha dado varios disgustos en estos días. Esa puta mala costumbre de no encajar bien la puerta. El niño que parece un insociable estando todo el día en casa. Como yo a sus años. Varios días de relax que no han sido los esperados de viaje y diversión pero si que han servido para leer y ver series, vamos... lo que me gusta. Sin embargo... algo no va bien. Estoy descuidando algo y no se el qué. ¿Hago poco deporte? ¿Pierdo el tiempo y debería coger algún curso? ¿Voy para los cuarenta y cinco y mi vida es una mierda? ¿El verano me derrite el cerebro? ¿Soy gilipollas? Bueno, si. Está opción siempre es muy acertada. Me exime de los palos que me llevo después. Pero a mi, precisamente, los palos me llegan por mi tranquilidad. Por no ver los problemas, por fiarme de la gente, por que al final todo, o muchas cosas, me resbalan y vivo en un continuo "carpe diem", pero ahora... ¿quién, o qué es lo que hay detrás de la
esquina? ¿Que es lo que me tiene en ese continuo desasosiego que no me deja relajarme? Sigo sin saber pero desde luego ya me estoy hartando. Lo primero es poner por escrito toda esta moralla, quizá así ponga en claro algo mientras tecleo, lo segundo recordar viejas técnicas de relajación esas en las que aprendes a respirar, ser consciente de lo que haces con tu cuerpo, creo que ahora lo llaman mindfullnes, lo tercero... volver a disfrutar, estoy haciendo últimamente muchas cosas porque creo que hay que hacerlas, no porque me apetezcan y las he metido tan dentro que no me había dado cuenta que ni yo las necesito, ni nadie me las pide. Cuarto dejar que los demás se equivoquen y no estar tan metidos en sus vidas. Eso si, que tampoco me fastidien a mi la mía con sus errores. (Aunque esto con mi hijo es inevitable.) Quinto... no sé, no llego a tanto ahora mismo pero desde luego la sexta y septima van a ser seguro dejar de ver series con temática oscura y sobre todo, sobre todo... echar un polvo que me quite las tonterías.







P.D. Buscando una foto para el texto he encontrado: El libro del desasosiego, de Pessoa. Al que estuve leyendo y buscando biografía hace poco, así que la menos ya tengo una idea de por donde viene la palabra que normalmente no suelo usar. 

19/7/17

Se acabó.

Se acabó. La he presionado y ha terminado por deshacerse. La he visto derramar lágrimas pero no quería que lo nuestro acabase. He vuelto a insistir. Le he recordado que la he cuidado como a nadie, pendiente siempre de su bienestar. Quizá algún día lo olvidé y se que le soy infiel con otras pero... ¡no ha podido darse cuenta! Ella siempre está en casa, en su rincón de la cocina. Sabe que la quiero pero hoy me ha demostrado que no puede seguir aquí. Se ha vaciado por completo y no quiere saber nada. Hoy es un día triste pero también lleno de esperanza. 
Ya me mirado su recambio. ¡Si! Lo sé debería guardar unos días de luto, echarla de menos antes de comenzar con otra pero... es dificilísimo que yo me quede sin café. 

In memorian.

18/7/17

Marcapáginas.

Los marcapáginas acusan de competencia desleal y poca profesionalidad, al parecer no aguanta en su posición más de diez minutos, al dedo índice.

15/7/17

La cita.


Llega temprano. Aún le quedan dos horas para su cita con el médico. Quizá debería esperar en una de esas sillas incómodas donde los pacientes se preguntan por el número y sus dolencias pero decide salir a la calle. Allí, sentado en un poyete, ve pasar la vida en vez de la muerte.

 No me ve cuando llego por su espalda y le susurro que hoy no tendrá que aguardar que lo llamo su médico. Que su hora ya ha llegado.

Mediciones.

La inteligencia de un individuo se mide por la cantidad de incertidumbre que es capaz de soportar. 

Inmanuel Kant. 

14/7/17

El cambio.

Algo se trocó. Siempre algo se troca. Y cambia. A veces podemos decir el día, la hora, el minuto exacto en que las cosas cambian. Aquel día perdiste el último autobús y tuviste que ir a casa andando, las 22:58, y ella giraba. Nunca la hubieses visto, ni hubieses recorrido aquellos 15 minutos caminando juntos si no se te hubiesen caído los libros, si no hubieses saludado a Pepe en el Correo, si hubieses llegado a las 22:57 a la parada. Otras... otras sabemos que cambian pero no tenemos la certeza del tiempo. Vemos que son distintas de como fueron hace años pero no podemos decir si tuvimos algo que ver, siempre queremos ser protagonistas, o secundarios de lujo, en la vida de los demás, lo que sabemos es que ahora nos afectan como si tuviésemos la culpa. 
O al menos esa es la sensación que tengo en estos días. Algo cambia, algo cambió y no se si seguirá haciéndolo pero solo me queda la esperanza de saber que todos los cambios, aunque yo no sea protagonista los voy a descubrir tarde o temprano. Voy a ser partícipe, aunque ahora mismo me cueste tanto entender como funciona la mente de mi hijo. 

10/7/17

Saliendo.

Salir del útero.
Salir de la infancia.
Salir a la calle.
Salir del armario.
Salir de las drogas.
Salir del curro.
Entrar en tu vida.
Salir del anonimato.
Salir del laberinto.
Salir de tu vida.
Salir...
     de la mía.

Lunes 10/07/2017.

Dice que lleva llamando desde hace mas de media hora. Que se ha desgañitado en la puerta y nos hemos olvidado de él. 
Tiene razón. Mi hijo no lo ha escuchado y si lo ha hecho no ha prestado atención. Y yo no quería desperdiciar un ratito en la cama comentando con él el cuarto encierro. Ha tenido que esperar pero ya está en casa. Ha entrado encabronado y peor se ha puesto cuando no le he hecho caso. Me he preparado un café y está refunfuñando en el sofá Esperando que termine de escribir, señalándome su presencia continua. Esperando que cierre el ordenador para plantarse en mitad del salón e imponerse para desde ese momento, para recordarme quien es y que no voy a poder librarme de él en todo el día. 

El Lunes, ha llegado. 

3/7/17

Blancanieves y el cazador.

Era un encargo fácil. Fácil y gustoso. Porque cuando la vieja me dijo que había que cargarse a aquella niñata ni me lo pensé.
- Eso está hecho. Cuando conmigo.
Todo el día de un lado a otro del castillo con su risita y su tontería a cuestas.
Pero entonces... ¡No sé que paso en aquel bosque! Allí estaba recogiendo flores, como si fuese una niña. ¡Y ya andaba por los dieciseis! Con su falda corta levantándose cada vez que daba un tirón a una margarita. No hacía distinciones. Lo mismo cogía correhuelas, margaritas, amapolas o jaramagos pero en cada tirón su falda volvía a subir enseñando sus bragas blancas. Era tan fácil darle una puñalada allí mismo.
Saqué el machete me dirigí a ella y cuando debía clavárselo, o cortarle el cuello. No se, nunca me pensé como matar. Ocurre y ya está. Pero... ¿Como fué que? ¡Joder! Que terminé cortándole aquellas bragas. Y... ¡ni se asustó! Todo lo contrario. Se giró y sonriéndome me acercó su culo a mi polla mientras seguía tironeando flores.




29/6/17

La ducha.

No recuerdo si era ella, o yo, quien salía de la ducha. Pero nos encontramos desnudos uno frente al otro y comenzamos a besarnos. Ella me mordió el cuello y con sensualidad me quitó la cadena que llevaba. La dejó en el lavabo y siguió mordiendo. Fue entonces cuando vi como resbalaba la cadena y entraba en el desagüe la agarré en el último eslabón antes de que se perdiese en las profundidades pero me arrastró con ella. 
Pensé que nos quedaríamos en la tubería, asquerosa por cierto, pero seguimos deambulando hasta entrar en la cañeria general. Por el sumidero escuchaba su voz llamándome. Se me antojó un viaje eterno hasta que llegamos al desagüe principal de la ciudad. Allí, prendida de una enorme rata la cadena colgaba lustrosa. Yo, en cambio, nunca me había sentido tan sucio. Fue una lucha desigual. Algún mordisco del roedor me pilló desprevenido pero pude arrebatarle la cadena. Subí por una de las escaleras de la cloaca. No estaba lejos del piso y el retorno ansiado se hizo angustioso con las miradas de los vecinos. 
Llamé y no abrían. Lo volví a intentar golpeando la puerta, a timbrazos y con gritos. Aparecieron los vecinos y por fin, con una toalla cubriéndole el pecho y otra para la cabeza apareció ella. 
Si, ahora lo recuerdo, era yo quien salía de la ducha y ahora volvía a entrar. 

25/6/17

Buenas intenciones.

El infierno está lleno de buenas intenciones. 
Bubo dixit.
Copiado de su madre que
a la vez lo trae del saber popular.




Todo el mundo ha tenido una novia a la que no le ha podido decir que no. Por que ella lo que quiere es agradar. Lo peor es que a veces cuesta enterarse. Por que a ver... ¿Cuando fue la última vez que desayuné yo en la cama? El día que tuve paperas con diez años y mi madre me trajo un colacao. No es por que no tenga tiempo, es que no me gusta. Pero claro... parece que a todo el mundo le debe gustar desayunar en cama y entonces te encuentras con esa novia que un domingo se levanta temprano y cuando piensas que lleva mas tiempo en el baño de lo que toca te trae una bandeja con tostadas, café con leche, y una flor que a saber de donde la habrá sacado. Y se queda allí mirándote comiendo en la cama, en esa en la que no hace mas de seis o siete horas habéis dejado como un pantanal después de una noche apasionada. Si comer en la cama ya es un suplicio tener que beber café con leche (yo me lo bebo solo) jode mas. No quiero pensar que las flores que trae sean de mi jardinera de la otra habitación, esas que he cuidado con esmero desde hace varios meses, aunque tienen toda la pinta. Pero ya digo que cuesta decir que no. Por eso el día que me invitó a su casa tenia preparado un plan especial para mi. ¡Joder todo sea por agradar! Había comprado cerveza, de la que a mi me gusta, San Miguel, me dijo. Y para allá fui todo ilusionado con un plan de pizza, película y cervezas. Un plan de puta madre si no fuera por que la cerveza era en lata y de esas especiales que parece que estas bebiendote un ceregumil con espuma, la pizza era hawaiana y la película de Michael Haneke. ¡Madre mía! El concepto parecía que lo tenía bien pero los detalles... Con los detalles no daba una. Pero ya digo, que todos hemos tenido una novia a la que cuesta decir que no. Y claro si sigue queriendo agradar y te propone un día de piscina con unos bocatas pues... que uno se apunta. 
Se supone que yo me encargaba de la logística, el coche, el lugar, las toallas, y mientras ella preparaba los bocatas. El mío de salchichón le dije antes de que cupiese cualquier duda. Por que un bocata de salchichón es de lo mejor que tiene el mundo, una de esas cien mentiras que cuenta Sabina para no cortarse de un tajo las venas. O eso pensaba yo hasta que abrí el papel albal en aquella piscina y vi una viena de pan integral con salami. ¡Joder! El salami no es salchichón. Es salami, no está malo pero no es salchichón. El salami no está entre los motivos para no cortarse las venas. Y el pan integral. ¿Pero se puede preparar un bocata con pan integral? El pan integral es para los sandwhich, para los aperitivos de picnic si me apuras pero para "bocata". Los bocatas no se preparan con pan integral. Y la tía te mira con cara de esperar la nota de selectividad cuando piensas que tienens mínino un siete y... y no vas a ser tú quien le diga que tiene que repetir exámen. Así que le pones tu sonrisa de satisfacción plena y le metes un tiento al sucedáneo de bocata como si fuese ambrosía. 
Todos hemos tenido una novia a la que no le hemos podido decir que no. Y vamos descubriendo que trae una de cal y otra de arena. Jode cuando te lo encuentras en el mismo plato pero siempre nos pueden las buenas intenciones. Nos encanta que quieran agradarnos y cuando encuentras a alguien que no para de hacerlo... cuesta decir que no. Por eso no le puse reparos al gintonic que ofrecía después del "bocata". Pero no se en que momento me despisté para que fuese ella quien pidiese y... ¡Joder, un gintonic rosa! Y es entonces cuando te das cuenta que es la mujer perfecta, encantadora, simpática, agradable, la hostia vamos... pero perfecta para otro. 

Gamers vs lectores.

Se ha roto el silencio en casa.

Una manada de lobos aulladores sale por los altavoces de la televisión. Adolescentes bregando con su juego favorito tienen a los personajes de mis libros arrinconados en la cocina. Snake, Drake, The Whitcher, Li y Zelda bregando y corriendo entre las habitaciones, tienen al Salvaje de Juan Guillermo, a Arturo Andrade, incluso al mismísimo Chinaski, acojonados en la cocina. Ahí es donde escribo, esperando que se diluyan poco a poco los pixels para salir cortar la corriente eléctrica. Y es que sin luz... no son nada. 

19/6/17

Vuelta y vuelta.

La cámara va soltando imágenes en el ordenador.
Mientras intento leer muchas chorradas en twitter.
Las fantasías y las risas de facebook.
Me niego a abrir un periódico y el aire acondicionado
me marca los tiempos.
Ana Popovic me canta al oído a través de Spoti,
y la vecina grita. Aún no se se si al perro o al hijo.
Las vacaciones (oficiales) han acabado pero aún
quedan dos días para organizar el mundo,
mi piso, o mi vida.

Aunque ahora mismo me conformaría con
ordenar solo medio decentemente
las carpetas del ordenador.

Ana Popovic

31/5/17

Ya cae.

Ya cae. No, no me refiero al mes de mayo, que también. Un mes que me encanta y este año se ha aprovechado muy bien. Me refiero a que ya viene, que están aquí. que por fin tocan unos días de vacaciones. Este año... (aquí hay un espacio de tiempo en el que me he perdido, he intentado borrar lo escrito por que no me cuadraba, también me han interrumpido pero... voy a pasar. Hoy toca un post de esos de que salga lo que tenga que salir. Pondré estos parentesis cada vez que me interrumpan hoy.) Este año las vacaciones, el tiempo de vacaciones es una mierda. (...) Unos días en los que voy a tener que ir a mi bola, nada de ir con el nene que para eso aún está en clases en ninguno de los dos periodos. Intento convencerme de que no pasa nada, que son las circunstancias y que debería aprovechar ese tiempo para mi, para ir a mi bola. Pero al final lo único que pasa es que no tengo casi nada organizado. Mi preparación para vacaciones se basa en tres cosas: llevar bañador y zapatillas, llevar la cámara vieja medio cargada, y una selección de libros para los próximos quince días. No voy a poder terminarlos todos pero no va a ser por falta de ganas. (...) Debería hacer cuarenta mil cosas. Siempre hay muchos pendientes en mi vida: organizar relatos (esto es algo que no descarto y por eso me llevo el ordenador), limpiar el piso en profundidad, hacer copias de seguridad, (...) arreglar la bicicleta, seguir con el curso de inglés, que va fatal... no sé, algo más productivo. Pero al final... al final sigo igual y no voy a hacer nada que no sea leer, fotos, senderismo y tomar martinis a las doce, un vino a a las dos, café por la tarde, y cerveza o whisky por la noche. Aunque... bien mirado, quizá eso sean unas vacaciones decentes. 

Este es mi último post de mayo, ¡creo! Lo mismo a última hora me sorprendo y el ocio me hace querer compartir algo más. Por que ahora mismo no es esta hora. Ahora mismo, estoy en el lugar de trabajo. ¡No! No estoy trabajando pero casi, porque faltan varios minutos para mi hora de entrada y como estoy en un apartado me están tocando la narices y se supone que no estoy. Que no debería venir nadie. Pero bueno... la cosa está en que estoy escribiendo antes de salir de vacaciones, aunque cuando tú leas esto yo ya tengo medio pie en remojo. (...) (Si llego a tener el pie en remojo desde que he escrito lo último hasta ahora salgo con los "deos corchos".)  Y hoy hay aún muchos pendientes. Entre otras cosas: trabajar. Que ya he empezado. 




Nos vemos. 

30/5/17

Lo que tengo y lo que no.

Tengo doce euros en la cartera.
Setenta céntimos más en el bolsillo
pequeño del vaquero. Y...
cinco días hasta que llegue la nómina.
Tengo cinco responsabilidades
de esas que nunca pediste
y te caen, si quieres bien...
si no, también.
Tengo sueño atrasado
y cansancio adelantado.
Tengo ganas de llorar
pero gasté las últimas lágrimas
cuando tuve que reír.
Tengo suerte
porque aunque desaparece gente
aún me tengo a mi.

23/5/17

El rescate.

Subió los diez pisos hasta la azotea arrastrando la lengua en los todos los escalones de las cuatro últimas plantas. Buscó en todos los bolsilos la llave de la azotea y por fin entró. Abrió y allí seguía ella. Esperando que la rescatasen de un suicidio premeditado. Apresurado, el aliento le faltaba en cada zancada vacilante mientras se dirigía a ella con los brazos abiertos para recuperarla. El ansia fue quien le hizo tropezar y empujarla. Desde el borde la vio volar.

22/5/17

Cambio de aires.

Desde ese día nadie vende barquillos en el parque, ni podemos cambiar cromos, tampoco los novios se besan en los bancos o se esconden tras los arbustos. Desde ese día los pájaros emigraron al sur y nunca volvieron, los árboles se marchitaron y del suelo sigue saliendo un olor a azufre.
Desde ese día, aquel tipo que salió del suelo hizo del parque su hogar e instauró el infierno.

18/5/17

El donante.


Sale con la cara blanca. El hombre que ojea una revista la tira a la mesa y se levanta. Se acerca. 
- ¿Te has mareado?
El otro no contesta, solo hace una mueca. 
- ¿Estas bien? - Vuelve a preguntar el de la revista.
- Que si papá que estoy bien. Es que me han sacado casi medio litro. 
Y el otro le coge la cara le mira con los ojos vidriosos y le echa el pelo para atrás. Le aguanta la mirada a su hijo un segundo antes de poner su frente en la de él que es casi de su altura. Le echa la mano al hombre y lo acompaña mientras intenta poner todo su cariño diciendo:
 - Serás gilipollas. 

15/5/17

Celos

Pensé que era buena idea hacer un trió con los calcetines desparejados. Meterlos con los que ya estaban bien acoplados en el cajón, mas que nada por no tirarlos, por darme una sorpresa cuando fuese a colocarlos. 
No sé que coño ha pasado pero ahora todos están rotos. 

El acordeón.

El acordeón tenía un nombre con letras extrañas. Quizá era checo. No sé. Si recuerdo al tipo, muy rubio, casi alvino. Tocaba entre las mesas, despacio, como si se hubiese parado el reloj. Caminaba lento y su música la acompañaba entre el bullicio de la plaza. Yo esperaba en la terraza con una CocaCola que ella se acercase del tanatorio. No me apetecía entrar y ver gente triste. Cuando llegó a mi lado traía los ojos rojos. Alguien le había contagiado sus llanto. Me levanté y le retiré dos lágrimas de su mejilla. La cogí por la cintura y entre las mesas bailamos aquella música lenta…

…y su sonrisa acompañó al acordeón checo por la plaza.

(Este es un micro de hace años. Uno de esos que traen malos recuerdos, pero buenas sensaciones. Hoy lo he recordado, quizá por la fecha, y lo he rescatado para dejarlo por aquí.)

13/5/17

Mi segunda cama - Borrego (Prod. SilvaBeats)



De vez en cuando mi nene me sorprende con algo que termina gustándome.

La resaca.

Todas las veces que follamos estábamos borrachos. Ella iba de ron, yo de whisky y nos fue bien durante tres meses. Pero un día ella pidió un zumo de melocotón, y yo una cocacola. Y follamos por última vez.

10/5/17

Cáncer

8 de diciembre de 1980 cuando papá salió de la casa a por tabaco. Yo nunca lo recuerdo fumando pero eso es lo que dicen las titas de él. Bueno… eso y otras cosas que mamá me prohibió decir durante muchos años. Por eso ahora cuando sueño que vuelve, que lo veo frente a mi siempre, lo veo con un cigarro en la mano.Ojalá no haya muerto de un cáncer de pulmón.

2/5/17

Un polvo o dos hostias.

La cosa está muy mala
dejo las tostadas con jamón
y me como una manzana.
Creo que voy perdiendo la ilusión
desde que no follamos por la mañana.
Desde que tomo zumo sin nada de ron
desde que no te cambia la cara
y vuelvo a meterme en un marrón.
No es que seas la mala
quizá solo necesitas un revolcón
o dos hostias, y taparte con la sábana
hasta que termine el chaparrón.

30/4/17

La llamada.

Coge el teléfono. Es tu madre, le dice. Y se lo pasa. La escucha decir que no tiene tiempo, que va a colgar. Y entonces le quita el teléfono. Paquita, grita. Que dice tu niña que estas cada día mas guapa, y empieza una conversación mientras que la hija abre la puerta y se va. Yo sigo en el sofá, hago como que escribo pero es mentira, solo tecleo incongruencias mientras tengo la oreja puesta en una conversación y un ojo en la salida de mi mujer. Hace un aparte con el teléfono y me pide un cubata. No puedo seguir haciendo como que escribo y le pregunto que prefiere, gintonic o whisky. Con una mueca, como de que le hace falta algo fuerte, me dice que whisky. Cojo uno de los vasos largos, otro corto para mi. Le coloco dos hielos a cada uno y dejo la botella al lado. Otra mueca mientras sigue hablando con mi suegra para que le eche el trago. Soy generoso, mas de medio vaso largo de Cutty Sark, mientras ella abre los ojos como para explicarme que me he pasado. Entonces le da el primer trago. Lo saborea. Mi suegra debe estar encantada, ya lleva mas de cinco minutos de charla con alguien. Si yo hubiese sido el destinatario ya hacía un rato largo que habríamos acabado la conversación. De hecho cojo mi vaso, le doy un trago y sigo escribiendo. Aparece mi cuñada en la conversación, su viaje, las niñas, los dolores de espalda, mientras yo sigo aparentando que escribo. La pantalla de la televisión cambia de imagen. Se ha hartado de la serie que había en pausa y se ha desbloqueado sol. Parece que se le acaba la conversación y habla de mi esposa. Le cuenta que está tan mal como ella. Un cojín sale volando desde mi lugar hasta el suyo. Otro gesto, esta vez mío. Uno de esos del tipo: no hables de lo mal que está que luego se preocupa. Lo que parecía una despedida sigue alargándose. Tengo que reconocer que entre las dos tienen más palique que yo escribiendo. El folio va con pinta de acabarse y siguen de cháchara. La vida, la vida, la vida es, la vida, la vida que mala es, parecen 091 quejándose lo mal que estamos. Yo miro el reloj de la pantalla. Espero que llegue la hora en la que aparezca Silvia, no debe tardar mucho. Pero aún quedan cinco minutos para que salga el bus de Granada. Ahora sí, ahora parece que ya acaba la conversación pero... ¡Croché! Derivamos en croché. Exactamente… ¿que es el croché? ¡No! Sin lugar a dudas entre dolores, preguntas indiscretas, y tratamientos de belleza, ¿o el croché tiene que ver con eso? Mi suegra ha tenido suerte de que Elisa coja el teléfono y le de vidilla. A mi me hubiese matada. Llega Silvia. Por fin algo de cordura en casa.

29/4/17

Zzzueño.

Me duemo. Empiezo a escribir con la idea de mover los dedos, de tener la mente ocupada en cualquier cosa, aunque sea una chorrada de entrada solo para no volver  a dar una cabezada. (Esos tres segundos de inconsciencia total están sumando algunos minutos y no puedo permitirmelo.) 
Ayer, después de currar salí con algunagente de la estación para dar una vuelta por la Cruces. ¡Impresionante Córdoba! Aunque nos cayese un mantazo de agua entre cruz y cruz. Al fin y al cabo ¿para qué ponen las carpas? El caso es que acabé tarde y hoy el sueño no termina de irse. Lo peor es que me pilla en el trabajo y no hay manera de hacer el paripé y dormirse. (¡Joder, otra cabezada!) 
Creo que no funciona mantener los dedos ocupados, voy a tirar de básicos: agüita en la cara y andar un poco. Pero es que voy a tener que hacerlo ya porque vuelvo a dormime. 




27/4/17

El cumpleaños.

Llegó al local siguiendo las indicaciones que había recibido. Su torpeza le había hecho dar mas vueltas de las que pensaba. Incluso la barba recien afeitada se asemejaba a la de un hipster incipiente. Abrió con la llave que traía el sobre. Ese que ponía: Urgente. En
Sus amigos hacía tiempo que habían acabado con el festín que le preparaban para su sesenta aniversario. Ahora se devoraban unos a otros.

23/4/17

La parada.

Subió los diez pisos hasta la azotea. Tenía que alejarse rápido de allí. Miró a un lado y a otro. Nada. Entonces levantó la vista como una súplica.. Silbó e hizo aspavientos mientras se acercaba al borde.

- Sáqueme de aquí. – Pidió.

La nube lo acogió y el viento empezó a soplar.

18/4/17

Natillas.

Amor es cuando a los dos os chiflan las natillas y la última termina caducando en el frigorífico esperando que sea el otro quien se la quede.


Bubo dixit.

12/4/17

50 mm

¡Decidido! Este año no me mareo. Nada de llevar dos o tres bolsas con aquello que puede hacer falta por si... y luego termina en la mochila en el mismo lugar que le diste cuando empezaste a hacerla para el viaje. ¡No! Este año voy a tirar de básicos. Para todo, para ropa, accesorios, y sobre todo para la cámara. Ni dobles o triples objetivos, ni dos cámaras, ni filtros, ni flash, ni hostias... Este año toca ir en plan fácil, o díficil según se mire.
Y ¿por qué? Pues porque este año apetece hacer fotos. Llevo varias salidas donde he cogido la cámara y no he realizado ni una fotografía. Un viaje a Sevilla, otro a Guadix y la cámara ha vuelto sin  disparar ni una vez. Esta vez no va a ser así. Pero tampoco tengo ganas de estar en plan reportero. Desde hace unos años los concursos de fotografía han proliferado en Semana Santa, al menos en Priego se han juntado hasta tres, y al personal se le va la pinza. Odio cuando un tipo enarbolando una cámara empieza meterse dentro de la procesión, cuando obliga a los penitentes a esquivarlo, a parar incluso el paso mientras se cree un Kevin Carter. Así que esta vez voy en plan tranquilo. Sin prisas, sin buscar excentricidades y aprovechando lo que dé de si un 50mm. Nada de detalles, a no ser que esté muy cerca, solo generalidades. Viendo las procesiones como hay que verlas, desde fuera. Fotos de recuerdos, de gente, de las de todas la vida, mejores o peores, sin forzar, una y para de contar. Nada de ir de fotógrafo de semana santa que últimamente me toca tanto las narices.
El mundo, al fin y al cabo, lo vemos en 50mm.

8/4/17

Las gafas.

Hablaba con un amigo de lo poco que escribo en los últimos meses cuando un tipo nos interrumpe. 
- ¡Oiga! Tengo yo unas gafas para eso. 
- ¿Como?
- ¡Unas gafas! ¡Para escribir!
Miro al tipo con una mueca escéptica. Pero debe ser un vendedor nato y girando la silla se posiciona entre mi compadre y yo. 
- Si, verá usted. ¿A que su problema es la página en blanco? 
- Pues... - Me niego a admitirlo.
- ¡Es normal! Usted antes miraba a una persona y conocía su historia. Mire a aquella señora. ¿Que ve?
- Pues a una mujer. 
- Pero usted antes no veía solo a una mujer. Usted veía historias. Miraba a la señora y podía contar como fue su noche de bodas, la pelea con aquel novio cuando vino de la mili, como lloró en el funeral de su padre. Usted no veía una mujer, antes veía todas las historias que esa mujer tenía tras de si, todas las que podían sucederle, no solo su vida si no todas las vidas que llevaba arrastrando y las que aún pululaban por su alrededor. Y recuperar eso es lo que yo le ofrezco con las gafas. 
Me quedo mirando al tipo como si me hubiese diagnosticado un cáncer y me pusiese en la mano una pastilla para curarlo. Después miro a mi primer interlocutor. Que sigue mirándolo incrédulo. A él no le gusta escribir, no tiene el cáncer. Ni si quiera me deja preguntarle.
- Aquí las tiene. - Me dice sacando unas gafas de sol viejas en una bolsa de plástico.- Son suyas por cien euros. Esto es mejor que cualquier curso que quiera hacer sobre escritura. 
- ¡Cien euros! Solo tengo... ¡Miguel déjame veinte euros! -Le pido a mi amigo mientras miro la cartera.
- ¿Pero que dices tío? ¿Tú estás loco? ¿Le vas a hacer caso a este tio?
- ¡Por tus muerto Miguel! Déjame los cuarenta euros. 
- Pero tío que me dejas sin pelas. Que no vamos a tener ni para pagar estas birras.
- ¡Mira Miguel...! Vete a la mierda y déjame los cuarenta euros. 
Miguel se levanta de la silla mirando al tipo de las gafas, saca el dinero y lo tira en la mesa. Sale apresurado del bar. Yo dejo el resto encima de los dos billetes de veinte y el tipo me alarga las gafas con una sonrisa encantadora. Recoge su dinero y se despide. 

Abro la bolsita de plástico que tiene las gafas. Hace años tuve unas parecidas. Las miro con miedo, están ralladas, cierro los ojos y me las coloco. Cuando los abro giro la cabeza hacia el espejo del bar, lo primero que veo es mi imagen. 

30/3/17

Nada.

Sigo siendo el mismo hombre que te hacía reír en el bar. Sigo siendo el mismo tipo que un día te vio feliz. Sigo siendo aquel chaval que andaba a tu lado con los libros en bandolera. Que recogía tu sonrisa con clips de colores, que te manchaba las mejillas de tinta cuando te pellizcaba tus oyuelos. Sigo siendo aquel niño que te quitaba caramelos de regaliz. Sigo siendo, pero sin ti... Sin ti no soy nada. 

29/3/17

Arturo Andrade.

Miró los libros que le rodeaban. Ahora no sabía si le acompañan o le cercaban. 

De El arte de matar dragones.
Ignacio del Valle.

21/3/17

Día de la poesía.

A algunos, (O sea, a mi.)
es decir, no a todos. (Por que el resto me da igual)
Ni siquiera a los más, sino a los menos. (Aunque alguno que otro te sorprenda)
Sin contar las escuelas, donde es obligatoria, (y algún hijodeputa te hace aborrecerla)
y a los mismos poetas, (o peor, a los que se creen "poetas")
serán dos de cada mil personas. (deberíamos añadir la música y quizá subiese el número)

Les gusta, (Me gusta.)
como también les gusta la sopa de fideos, (Odio la sopa de fideos, pero me encantan el salmorejo)
como les gustan los cumplidos y el color azul, (y besar a los que queremos)
como les gusta la vieja bufanda, (o unos vaqueros gastados)
como les gusta salirse con la suya, (o una discusión)
como les gusta acariciar al perro. (mirar las minifaldas de primavera.)

La poesía,
pero qué es la poesía. (Olvidate de Bécquer.)
Más de una insegura respuesta
se ha dado a esta pregunta. (Y para gustos los colores.)
Y yo no sé, y sigo sin saber, y a esto me aferro
como a un oportuno pasamanos. (Como a su pecho en la noche.)

De Wislawa Szymborska con comentarios hechos a "voleo".

¡Feliz día de la poesía!

14/3/17

de gente que no sabe lo quiere.

Miénteme, le pidio. Y ella lo hizo. Todo iba bien pero un día las mentiras se descubrieron y él no pudo aguantar esa traición.

3/3/17

Clarividencia.

Trescientos sesenta y tres periódicos al año, trescientos sesenta y cuatro los bisiestos y sigue sin entender la estupidez humana pero hoy la clarividencia le ha llegado de pronto. Arruga el diario y lo arroja a la basura. Cambia la radio de noticias por música. 

Y se convierte en un estúpido feliz. 

1/3/17

Borges y yo.

Al otro, a Borges, es a quien le ocurren las cosas. Yo camino por Buenos Aires y me demoro, acaso ya mecánicamente, para mirar el arco de un zaguán y la puerta cancel; de Borges tengo noticias por el correo y veo su nombre en una terna de profesores o en un diccionario biográfico. Me gustan los relojes de arena, los mapas, la tipografía del siglo XVIII, las etimologías, el sabor del café y la prosa de Stevenson; el otro comparte esas preferencias, pero de un modo vanidoso que las convierte en atributos de un actor. Sería exagerado afirmar que nuestra relación es hostil; yo vivo, yo me dejo vivir, para que Borges pueda tramar su literatura y esa literatura me justifica.
Nada me cuesta confesar que ha logrado ciertas páginas válidas, pero esas páginas no me pueden salvar, quizá porque lo bueno ya no es de nadie, ni siquiera del otro, sino del lenguaje o la tradición. Por lo demás, yo estoy destinado a perderme, definitivamente, y sólo algún instante de mí podrá sobrevivir en el otro. Poco a poco voy cediéndole todo, aunque me consta su perversa costumbre de falsear y magnificar. Spinoza entendió que todas las cosas quieren perseverar en su ser; la piedra eternamente quiere ser piedra y el tigre un tigre. Yo he de quedar en Borges, no en mí (si es que alguien soy), pero me reconozco menos en sus libros que en muchos otros o que en el laborioso rasgueo de una guitarra. Hace años yo traté de librarme de él y pase de las mitologías del arrabal a los juegos con el tiempo y con el infinito, pero esos juegos son de Borges ahora y tendré que idear otras cosas. Así mi vida es una fuga y todo lo pierdo y todo es del olvido, o del otro.
No sé cuál de los dos escribe esta página.

Jorge Luis Borges. 

Todo un hallazgo este texto. 

28/2/17

La La Land

Los musicales son como el porno. Sin venir a cuento se ponen a cantar, a bailar o a follar. Lo importante no es la historia si no el movimiento y ruido que hacen en esos intervalos de la narración.

Bubo dixit. 




Por cierto, curioso que La La Land tenga un título que sugiere el chiste ese del cunnilingus con la canción de Massiel. 

21/2/17

Matar a besos.

La cogió desprevenida y le plantó un beso en el cuello mientras con la abrazaba fuertemente. Tan fuerte era el cariño que los ojos se le salieron de las órbitas, tan fuerte que las costillas le saltaron, un cariño tan fuerte que cuando la vio desfallecer le plantó otro beso y la dejó caer en el suelo. 

19/2/17

5 discos.

Al final del año pasado tenía la idea de escribir varios post con listas de cinco contenidos. Creo que conseguí terminar alguna, la de las series y la de los tweets. Por ahí se me quedó pendiente una de canciones identificativas de parejas, otra de libros, otra de fotos y una de discos. La de discos llegué a terminarla. Fui capaz de identificar cinco discos que han sido importantes. Aunque ahora, una vez que he vuelto a ver la lista, no se si la hice pensando en el disco entero, o sea, todas las canciones, o solo en la importancia que tuvo en esa época ese dísco. Además me faltan, y no, no he puesto solo discos en español, es que para mi son los mas importantes. Que sí, que habrá discos que son las hostia y seguramente en esta lista debería estar Money for Nothing pero terminó cayendose de la lista así que... Esto se queda así:

 - Tren de Medianoche. Con este disco descubrí a La Frontera, así que tiene que entrar. Quizá no sea el mejor pero para mi es imprescindible. Rock y Country a partes iguales. Borrachos de salón y canciones desesperadas. Descubrir este disco con quince años es una de las cosas que mejor te pueden pasar. Canciones como "El Rey de la noche" hacen que la autoestima suba muchos enteros, o "Todo cambiará mañana" que al final viene a ser un canto de esperanza cuando es lo único que queda. Echarse a morir y ya vendrán las cosas de otra manera cuando salga el sol. Y por su puesto una de mis debilidades fronterizas: "Siempre hay algo que celebrar" que es mejor que el himno de la Alegría o cualquier canción de Diego Torres para subir el ánimo. 


 - A por ellos que son pocos y cobardes. Ni Pérez-Reverte volvío a escribir igual después de "El Club Dúmas" ni Loquillo volvió a cantar igual después de aquel año del 88 en que grabó el directo en la Sala Zeleste. Lo mejor de Loquillo, de los Trogloditos y de Sabino Mendez, aunque ya no esté en el directo, está en este disco. Aquellos jovenes rebeldes que decidieron hacerse mayor en la sala y antes nos dejaron un disco doble antológico. Loquillo, con su chulería, y su elegancia nos ha enseñado a crecer a los que vamos una generación por debajo. Quizá no entendimos bien su disco de diez años después "Nueve tragos" pero solo era cuestión de tiempo. De llegar a sus años, y por su puesto sin había alguna duda al años siguiente con "Cuero Español" y sus "Cuando fuimos los mejores". José María Sanz Beltrán se convirtió con este disco en el hermano mayor que nos fue marcando el camino. Y sigue haciéndolo. 

 - Hotel dulce hotel. Si bien este disco se publicó a la misma vez que "Tren de medianoche" (1987) a mi me llegó mas tarde. Al menos dos o tres años después. Principios de los noventa. o quizá finales del 89. Este fue mi primer disco,  completo, de Sabina. Lo había escuchado en la Mandrágora, infinidad de veces en el casette del coche aquellas "Malas compañías" que resultan ser las mejores, alguna de Viceversa pero este fue el que me llevó a buscar aquellas cantautores que escuchaba mi hermana, a descubrir a Silvio, a Leonard, a Jara, a no hacerle ascos después a gente que no necesitaba una guitarra eléctrica para ponerte los vellos de punta. A valorar las letras y descubrir que hay poesía entre la música. Hotel, dulce hotel, fue el primero pero después han llegado muchos mas. Y así paso incluso de década. 

 - Cosas mías. Este disco fue una apuesta. Una de las mejores que he hecho. Creo que es uno de los discos mas completos que hay en mi casa. ¡Ni una! Ni una canción la considero mediocre. Antonio Flores, con pinto de indio, de nonaino de pro, se marca un disco espectacular de los que conocía una o dos canciones y me deja con ganas de mas. Con ganas de mas Antonio, de Rosario, de buscar de nuevo a Ketama, de cantautores. Con ganas de esas letras que hablan de mucho mas de lo que cuentan. Como meter en una disco una canción de amor, de desamor, como un gitano le canta a un gay, a su hija. Antonio Flores es puro sentimiento en este disco y a mi me engachó aunque solo conociese de él su "Gran Vía". (Esa canción que siempre canto en Granada en vez de hacerlo en Madrid)

 - Isla mujeres. Compré este albúm porque tenía la canción de una serie que me encanta: "Raquel busca su sitio". Después de poner la canción de Raquel había que seguir escuchando el resto. El disco coincidió con una etapa de cambios importantes. (Se publicó en el 2000.) Me había casado, estaba a punto de tener un hijo, me había metido en una hipoteca y trabajar se hacía de manera constante. He vuelto a escuchar a David Broza en otros discos pero no llega a ser alguien me me disloque, sin embargo este disco se ha colado como uno de los esenciales en mi vida. Desde hace dieciseis años hay una canción que silbo constantenmente, puede que esté varios días sin hacerlo, alguna semana incluso pero todos el que me conoce bien me ha escuhado silvar "Carmela" que es casi como un himno. Curioso que después del divorcio: "Navegando solo" sea otra de las canciones que mas silvo y también pertenece a este disco.  ¡Si! Sin lugar a dudas se merece estar en esta lista. 

Me faltan discos, me falta música, mucha música. Me faltan los discos que me han dado tanta vida estos últimos años, Fito, MClan, Norah Jones, Dire Straits, Stray Cats, Marea o Ismael Serrano... ¡Vete tú a saber! Incluso el alegrón de esta mañana con Andrea Motis pero... esos irán a otra lista. La de hoy se queda como está. Si no los has escuchado... Prueba a busca en Spotify. Espero que entren en tu vida tan bien como en la mía. 


14/2/17

San Valentín.

Que, al parecer, la discusión no es por regalarle una caja de bombones cuando me ha dicho varias veces que está a dieta. Que el problemón viene por haber dicho:
- ¿Siii? Pero si estas igual.

Guau!

¡Empezó él! 
Yo paseaba de camino a casa. Andaba despacio, sin prisa por llegar. Eran las una y media de la mañana y ya había terminado mi jornada en el curro. Era el momento de saborear un cigarro, de escoger música en el Ipod sin estridencias. Un poquito de jazz que le he vuelto a coger el gusto después de ver La La Land. El mundo, en esos momentos, es ese lugar mágico al que aspiramos llegar cuando nos jubilemos. Y lo estaba disfrutando hasta que sin previo aviso:
- ¡GUAUGUAUGUAUGUAUGUAU!
El corazón empezó a bombear a un ritmo frenético, los pulmones se llenaron de humo, el retemblido de mi cuerpo hizo que diese un tirón a los auriculares que salieron volando y casi se llevan media oreja. Dos segundos mas tarde, cuando me empezaba a recuperar, pude verlo. Un boxer color canela seguía ladrando con las patas en alto junto a una reja. Los dientes y la boca babeando mientras yo miraba a uno y otro lado casi como si quisiera disculparme de la enajenación canina por tanto ruido. 
Seguí mi camino pero el agradable paseo había terminado en una revolución en mi organismo para encontrar la paz. Imposible hasta que llegué a casa.
Fue la primera vez. El día siguiente al pasar cerca de la casa donde se encontraba el perro iba preparado. Ni idea de donde estaba, no lo ví y tampoco lo busqué esperando en la reja por si lo encontraba. Segui mi camino. Pero al día siguiente, de nuevo con un andar pausado, y unas bolsas del supermercado el boxer volvió a darme uno de esos sustos que me dejaban el corazón en la otra acera. Lo peor no era el susto, que también, era la sensación de imbécil que se me quedaba. Por que cada susto iba seguido de un salto y una contracción del cuerpo que me hacía parecer una niña histérica y asustada. Las manos en el cara, la pierna mas cercana a la reja encogida en la cadera mientras la otra temblaba. Una situacion vergonzosa que, si bien no veía casi nadie, a mi me daba la sensación de que toda la calle se descojonaba a mi costa. Incluido el perro que tenía esa pinta de Lindo Pulgoso cuando rie.
Dos semanas me ha tenido el perro en vilo. Unos días lo esperaba y ya no acojonaba tanto, otros volvia a olvidarlo y volvía a parecer esa niña asustada. ¡Vergonzoso! 
Pero ya ha llegado. ¿Sabes esos silbatos que son de ultrasonidos para los perros? Me he hecho con uno. Ahora cada vez que estoy cerca de la casa lanzo un silbido, que no oye nadie y el boxer comienza a ladrar como si le fuese la vida en ello. Tengo que reconocer un pequeño placer cuando entro temprano a trabajar. Y a las cuatro y media de la madrugada paso con la bici, o andando y suelto un pitonazo inaudible para todos. Para todos menos para mi amigo que revoluciona a todo el barrio a horas intempestivas. Creo que dos turnos mas de trabajo en horas tempranas harán que deje de ladrar durante mucho tiempo. A mi me encantan los animales, tanto, que no puedo tenerlos secuestrados en casa. Quizá el pobre no tenga la culpa pero desde luego... ¡Yo no empecé!

12/2/17

Amarga

Amarga como la bilis
de una borrachera en lunes.
Como la hostia de tu padre
cuando los huevos son negros.
Como el primer beso
que te negó aquella gorda.
Amarga como las heridas
del vacileo.
Como el trabajo
que no te dieron.
Igual que el licor de almendra
para impresionar a una idiota.
Amarga como todas las despedidas
como la última, como la primera.
Amarga porque ella ya no es dulce.

9/2/17

La instalación.




(Para @FeoMontes,
que me dio un tirón de orejas el otro día 
y ya tocaba un relato en este plan.)



Busco al camarero para pedir la tercera cerveza. Mi hermana se levanta de la mesa y llama a una tía que acaba de salir de un coche mal aparcado.
- Marga - Grita.
La tal Marga se acerca con prisa. Le da dos besos. Yo me levanto, me presenta, y le doy otros dos.
- ¿Que haces aquí? Pensaba que hoy no venías a recoger a Jaime.
A Marga se le abren los ojos. Le cambia la cara.
- ¡Hostia! Es verdad. Hoy lo recogía Nicolás. ¡Me cago en...
- Bueno... ya que estás aquí... ¿Te tomas algo?
- ¡Joooder! - Exclama Marga.
El camarero se presenta. Pido mi tercera cerveza, mi hermana otra caña y Marga, después de dudar un rato, se pide un tercio de Heineken. Se sienta con nosotros. Nos comenta el día tan estresante que lleva. Mira su coche varias veces.
- No te preocupes. - Le digo - El coche que bloqueas es el mío.
Marga le da un trago generoso a su tercio dejándolo en poco mas de la mitad. Suena el timbre del colegio.
- ¡Hostia! - Mi hermana se levanta de la mesa. - Me voy, que ya están saliendo los niños.
Nos deja a Marga y a mi en la mesa mientras el camarero trae tres tapas. Se las ofrezco a Marga. Que sigue hablando de su trabajo y del despiste que tiene en los últimos días. Por fin se ha mudado a un piso mas pequeño. Aún tiene las cosas por medio y ya que no va a tener a Jaime hasta mañana aprovechará para colocar las cosas.
- Lo peor es el ordenador. - Me dice - Necesito conectarlo a la televisión y a los altavoces y odio tanto cable suelto.
Me ofrezco a ayudarla si me invita a otra cerveza mientras lo conecto. Marga acepta. La casa está cerca y los dos nos montamos en su coche. Piso un peluche y ella se inclina para cogerlo y tirarlo sin miramientos a la parte de atrás. Ver su cabeza entre mis piernas me he excitado. Ella sale con el coche sin mirar el retrovisor. Un tipo nos saluda con un pitonazo. Marga levanta el brazo. No distingo si es una disculpa o un aspaviento.
 Su casa es como su coche. Todo está patas arriba. Entra y recoge una camiseta, algún juguete suelto y mientras me dice que me siente la veo huir por el pasillo. Cuando vuelve ya no trae la cazadora de cuero. El jersey se le queda pegado a su talle. Tiene buenas tetas y tardo en darme cuenta que las miro mas de lo que la elegancia permite. Ella me sonríe. Me señala la televisión, un ordenador portátil con varios años y un equipo de música y un amasijo de cables que es imposible distinguir cual es cual. Vuelve a perderse mientras voy curioseando el equipo y  regresa con dos Heineken. Se sienta en el brazo del sofá, está tan cerca que puedo oler su pelo. Deja una de las cervezas en la mesa y a la otra le da un buen sorbo. Sus tetas se le marcan cuando levanta la cerveza. Gira el cuello y se duele. Me esta poniendo nervioso con tanta actividad.
- Marga, siéntate y te tomas la birra tranquila. Esto es solo un momento.
Empiezo a organizar el cableado y ella se sienta en el sillón. Vuelve a darle un sorbo a la cerveza que la deja tirando. Se levanta. Se acerca de nuevo y me trae la que ha dejado en la mesa. Le doy un sorbo y se la vuelvo a entregar. Ella le da otro trago. Verla desde el suelo es aún mas impresionante. Se pega y mira como voy conectando los cables.
- ¿Ves? ¡Es fácil! Aquí tienes que conectar estos y este último a la televisión.
Y entonces me levanto haciendo que Marga derrame mi cerveza en la camisa.
- ¡Dios! Encima te pongo perdido. Anda quita y te limpio esto antes de que quede mancha.
. ¡No! Si no...
Pero Marga ya me está desabrochando los primeros botones. Es entonces cuando me doy cuenta de lo que está haciendo. Con la camisa desabrochada le cojo las manos, está tan cerca. Y me lanzo a su boca. Marga se sorprende, solo un segundo, como si la hubiesen pillado en falta pero después es ella la que se lanza buscando la mía. Nuestras manos empiezan a bailar por el cuerpo del otro, la ropa va desapareciendo, la camisa, su jersey, un zapato vuela por el salón,  mientras seguimos como ciegos furiosos tanteando la piel. Paramos un segundo para coger aire, para reconocernos y ser conscientes de lo que hacemos y con quien. Solo un segundo. Yo la vuelvo a besar, ahora mas pausado, y empiezo a buscar su cuello. Sus pechos. Voy bajando con mis labios por su costado, y me sitúo de rodillas con los ojos en su ombligo, allí meto la lengua. Marga se contrae, tiene cosquillas. Mis manos desabrochan un cinturón y empiezo a bajar sus vaqueros. Tiene unas bragas de cuadros rojos, casi infantiles. ella sonríe, y susurra algo así como: si lo llego a saber. Mis dientes muerden la tira de arriba mientras mi lengua juega con los cuadros. Sus vaqueros, con mas apuros de los previstos, terminan en el suelo. Ella me coge de la cabeza mientras sigo jugando con la tela de sus bragas cuando mis manos se disponen a retirarla ella me gira la cabeza para que la mire. Me obliga a levantarme. Vuelve a besarme. y ahora es ella la que juega en mi cuello. De un empujón me tira en el sofá. Su lengua se entretiene en uno de mis pezones. Mientras sus manos desabrochan el cinturón. De un tirón desabrocha tres botones de los Levi´s. Empieza a retirar el vaquero y doy un respingo en el asiento para facilitarle la labor. Los vaqueros siempre son un engorro para el sexo rápido, Los zapatos se interponen pero ella los quita con facilidad. Se incorpora y tira de los perniles, me quedo con un boxer de lunares. Disfruto mirándola y se recrea mientras ser quita las bragas. Les estaba cogiendo cariño pero me excito mas si cabe cuando veo que está totalmente depilada. Su sexo se muestra sin pudor y me adelanto para saborearlo plenamente. Marga ya está mojada y me lengua disfruta jugando con sus labios. Me coge la cabeza, me aprisiona entre sus muslos y durante unos segundos casi no puedo respirar. Entonces me empuja. Coloca mis piernas entre las suyas y se pega a mi cuerpo. Con su mano derecha coge mi polla y juega unos segundos con ella antes de introducirla suavemente en su
coño. La primera embestida es dulce, la segunda hace que sea un acople perfecto, la tercera, la cuarta, la quinta, la sexta, son rápidas y ágiles. Le agarro el culo para marcar un ritmo mas lento. y ella me retira las manos, me las coloca sobre la cabeza y sigue con sus embestidas. Sus tetas están a la altura de mi boca y busco un pezón. Lo chupo, Ella sigue con mis manos cogidas y un ritmo frenético. Va a conseguir que me corra en momentos. ¡No! No puedo permitirlo, Me está gustando mucho. Con un esfuerzo recupero mis manos y agarrándola de la cintura la tumbo en el sofá. Ahora soy yo quien marca el ritmo. Mi polla baila en la puerta de su sexo. Me sonríe. Con la punta le acaricio el clítoris. Me recupero pero ella me coge el culo y lo aprieta contra sus piernas. Otra vez dentro. Me marco un ritmo lento. Entro y salgo de ella con la facilidad que da estar lubricados. Me coloca sus piernas encima de mis hombros, entonces la penetro con fuerza. Vuelve a marcarme el ritmo con sus manos en mis nalgas. Una embestida, otra, otra. Su cara se contrae y una mueca refleja su orgasmo. Sigo embistiendo y cuando estoy a punto de correrme es ella la que separa sus piernas y se separa. Me coge la polla fuerte con la mano izquierda y me levanta del sofá. Tira de mi hacía la mesa. Como si fuese un perrillo faldero la sigo. Se tumba en la mesa. Me ofrece su coño de nuevo. La misma facilidad para volver a entrar dentro de ella. Mis manos van a sus tetas. Mientras sigo empujando, la mesa y Marga gimen a la vez. Mi aguante no llega a mas. Saco la polla de su coño y me derramo entre sus muslos. Marga sonríe. Me mete un dedo en la boca. Me mira y me pregunta...
-  Una ducha?



23/1/17

Córdoba.

Uno puede ir a una ciudad y enamorarse en ella.

Lo jodido es cuando de quien te enamoras es de la ciudad. Entonces estás perdido. (Y encima contento.)



Bubo Dixit.

19/1/17

El diario.

- Mátame. – Le pide.
Ya no recuerda cuantas veces lo ha escuchado. Pero de nuevo su esposa es consciente de que la vida no está con ella. Que no quiere seguir sin reconocer a sus hijos, que no quiere comer sin necesidad de que alguien le recuerde que debe hacerlo, que no quiere vivir. Lo mira suplicante y entonces él accede. La coge de las manos y cierra los ojos.
- ¿Cómo se atreve? – Le dice ella seria, mientras le retira la mano.
Y entonces se da cuenta que ya no está con él. Que vuelve a verlo como un desconocido. Antes de acurrucarse en el sillón y mirarlo con desconfianza. Se levanta y a duras penas consigue asearla. La viste con el traje que llevó en la boda de su hijo pequeño. El que tanto se parece a él y ella suele regañarle como si fuese un pequeño en vez del ingeniero que vive en Orense. Ese que tiene tan poco tiempo.
Tantas pastillas en el botiquín. Tantas que por fin, por una vez, van a servir para algo. Brinda con ella con una copa de vino mientras va tragando dos pastillas cada vez. Ella no recuerda porque brindan y empieza a tener sueño. Otro brindis, otra tanda.
- A su salud- Le dice ella. – Es usted muy simpático.
El sueño le vence pero aún quedan pastillas, y él le pide que se las tome. Ella accede.
- La última papa. Ya no quiero mas. – Le pide.
Y entonces, con una lagrima resbalando por sus mejillas, le dice que si, que es la última. Que puede dormir tranquila. Ella se recuesta. Él la acomoda y le deja el vestido arreglado. Sale de la habitación cerrando la puerta. Se sienta en el salón. Comienza a escribir. Rompe el papel. Retoma otro. Llora desconsolado. Cuando deja la carta encima de la mesa. A sus hijos, escribe en sobre.
Recuerda aquella cuerda de compró uno de su hijos para hacer montañismo y va a buscarla. De algo va a servirle aquellos años en el cuartel de El Ferrol. El nudo le sale perfecto. Lo deja colocado junto a una silla. Antes vuelve a la habitación y la besa. Ella no le responde.






18/1/17

No es lo que parece.

Las cosas no siempre son lo que parecen. Aunque otras veces si, si son lo que parecen. Solo que nos gusta verlas distintas. Nos gusta pensar que no nos hemos equivocado otra vez y que lo que vemos, lo que nos hace sentir eso es tan grande, tan fuerte, que no puede sentarnos mal. Y empezamos a disfrutarlo desde el principio. ¡Joder es tan genial que parece mentira! Y lo es. Es mentira. Pero no queremos verlo. Y así nos va. Que vemos lo maravilloso. Si algo no nos cuadra hacemos como lo mismo que cuando cae un pizco de patata al suelo limpio, patada y termina debajo del mueble bar. No queremos ver ninguna imperfección en lo perfecto. Después te das cuenta que, de vez en cuando, hay que barrer debajo del mueble, que lo que se ha ido acumulando hay que recogerlo, quizá ese no era el momento adecuado, y dejarlo limpio para que se vaya ensuciando de nuevo. 
Las cosas no siempre son lo que parecen. Y aunque lo parezcan, no siempre lo son. Las cosas son como las vemos. Y a veces con suerte las vemos siempre bien, y otras... otras podemos verlas como lo que son imperfecciones que hay que cuidar, que mantener para que estén bien, para que sigan en nuestras vidas por mucho tiempo, Mantenerlas, cuidarlas, y mimarlas si es necesario. No tener en cuenta lo malo y si se tiene hacer una limpieza pero seguir con ellas. 

Pero claro... también te puedes dar una vuelta por "los chinos" y comprar barato lo que quieras. Te puede parecer la hostia en verso, pero desde ya te digo que lo que compres no es lo que parece. A no ser que lo que quieras sea un juguete para un rato. 

Y toda esta parrafada a que viene? Pues eso, a que las cosas no son lo que parecen pero otras si, Y por mucho que quieras mantener un capricho que te diste en los chinos no te puede durar toda la vida. Ya sabías que era prácticamente imposible. 

17/1/17

Hambre.

(La otra versión de "Desvestida para tu fiesta". De Juana la Loca.)


Le gusta provocarme.
La miro de reojo mientras se desnuda. Ella lo sabe
y lo hace lentamente. Como si fuese un premio
que se da. (Que me da.)
Se quita las medias dibujando
lineas en sus muslos, flechas que me indican
el camino a seguir. Las baja como caen
los párpados de sus ojos cuando come helado.
Sin prisas, Con toda la lujuria en las yemas.
Aguanto la respiración, jugando a que no me importa
pero cuando su sujetador cae...
y sus pechos bambolean libres...
es imposible mantener la cordura,
ni la respiración, ni los ojos disimulados
y clavo mi mirada en ellos.
Le gusta provocarme.
Le gusta jugar y los masajea
como si le diese gracias a Dios
por lo grandes que los hizo,
por la liberación que siente ahora,
por que sabe que son mi objeto de deseo.
La lengua me recorre el labio inferior,
lo saboreo
como si fuese uno de sus pezones,
igual que un dulce para un diabético.
Fruta prohibida, deseada, tan cerca.
Ella me sonríe y sigue su juego,
sus dedos viajan a la única prenda que oculta
su piel. Entre los muslos se esconden y la retiran
bailando antes de caer entre sus pies.
Se muestra libre
y la miro con todo el deseo que llevo guardado
desde la última vez.
Es mi cena
y tengo hambre.
Mucha hambre.

Hace frío.


Hace frío. Intento engancharme diciendo que en Córdoba no hay la temperaturas de Polonia. Que con un grado no te congelas. Solo es necesario usar camiseta interior, tan poco habitual en mi, o incluso algún jersey de lana. Dejar las camisas de entretiempo y coger, para variar, alguna con algo mas de empaque. Quizá, todo esto, es solo una manera de negarme a que el invierno está aquí. A no querer ver que el frío, el puto enero, está anclado en la casa, en las calles, en mi vida. 
Hace frío. Pero aún puedo aguantar unos días mas. Y no voy a reconocer que está haciendo mella en mi. Hace frío. Pero hay botellas de anis, de brandy, que suben la temperatura. Y también... fotografías estivales que se refugian en la esquinas caldeando, aunque sea por unos minutos el ambiente. 


P.D. La fotografía es de este verano. Turistas entrando en la Mezquita. Un taller de escritura que me obligaba a pasar todos los días por el patio de los naranjos a las cinco de la tarde. Ni uno solo, con cuarenta grados a la sombra, hizo que maldijese el verano. ¡Bendito mes de Septiembre!



15/1/17

...

Necesito que las personas vengan con libro de instrucciones. En caso contrario que no se admitan quejas de un uso acorde a las reglas preestablecidas en la sociedad. Si aún así no es acertado una simple indicación también es bien recibida para modificar el comportamiento. 
Lo que no tolero es que vengan pidiendo el libro de reclamaciones después de pasar la garantía. Ahora solo queda arreglar el desaguisado por tu cuenta o comprar uno nuevo. 

8/1/17

Frustraciones pasadas. (Y presentes.)

Cambio la agenda de un año para otro. Escribir todos los contactos que hay me lleva una tarde entera. Pero la nueva agenda no trae ese listado que aparece siemrpre al final de la A a la Z, Ese donde la página de la Q se queda en blanco y la X e Y la acompañan con mas tonterías que personas conocidas. (Solo conozco a los Yébenes y a esos los tengo como Aguilera.) El caso es que en la agenda hay algunas frustraciones que empezaron como proyecto y no llegaron a cuajar. La falta de tiempo, mi excusa favorita, la desidia, y sobre todo una apatía generalizad en el 2016 lo han hecho posible. Hoy para mortificarme en mi incompetencia voy a publicarlas en esta entrada. (Quizá esto sea un espolón para acabarlas de una puta vez, o simplemente para ratificar mi desidia y dejarlas pasar para siempre.)

1.- Proyecto Miradores: Se basa en fotografiar Córdoba desde los miradores que tiene. La Asomadilla, la torre de la Mezquita (perdón: Catedral), el Mirador del Brillante, el Hotel Palace, la terraza de la Casa árabe... y alguno que otro que debería descubir en esta ruta. Resulta que tengo fotografías casi de todos pero en distintos año, en distintas estaciones y la idea era hacer una en un mes completo. Ahí está... en pendiente. 

2.- A4 cartulina. Manchas: Esta frustración viene de hace muchos años. En los últimos me la ha "potenciado" Angela con sus fotografías y post en los que Pere ha realizado una exposición que me gusta mucho. Desde hace años en los que con café y A5 realicé un mapa del tesoro para mi nene me ha gustado manchar el papel en blanco. Café, Tinto, Cerveza, Fruta... manchas que son las que dan vida al papel. De momento... solo tengo una con café. Un redondel oscuro detrás de una fotografía en el salón. 

3.- Premio EuroStar: Hace cuatro años seleccionaron y premiaron una fotografía del premio EuroStar hoteles. Desde entonces vuelven a enviarme todos los años información para participar y, aunque lo intento, no lo consigo. Con este premio me pasa lo mismo que con el "Caminos de hierro" de Renfe o el de "Relatos de Alsa". Nunca he participado en ellos pero son de hace tantos años que ya no me lo planteo. Aunque sigo fotografiando vías de tren y pensando en ese premio y haciendo relatos de autobuses con la idea de enviarlos a Alsa (alguno de esos me lo premiaron los del Consorico de Transportes.) El premio Mezquita de Fotografía, el de novela corta de Diputación, el de Vicente Nuñez, el de... 

4.-Ir a Bilbao: Desde que abrió la linea Córdoba - Bilbao le tengo ganas. Ya lleva tres años y no hay manera de que algún día me decida a coger el coche de última hora, este en Bilbao 24 horas y vuelva a la noche siguiente. 

5.- Dejar de corregir e imprimir: Cada día hay mas morralla en el disco duro. Muchos microrelatos, relatos e incluso algún amago de novela. Todo esto no deja de ser una mierda y siempre pienso en dejar de escribir, corregir y lo mas importante: imprimir y decidirme a enviarlo por si a alguien le interesa. Esto es una frustración presente, pasada y, casi seguro, futura. 

6.- Olvidar el teléfono de mucha gente: Cosa que hoy por hoy es casi imposible. Aunque el tiempo que dedico a cambiarlos de agenda, este año, lo he dedicado a otra cosa. 


Hay mas frustraciones, seguro. Pero estas son las que tenía en la agenda del 2016. 

Cambiar de agenda, 
es cambiar las frustraciones pasadas 
por presentes. 

5/1/17

Gaspar.

Hace años que me desilusionaron diciendo que eran los padres. Ahora soy yo quien soy rey y padre y coloco los regalos bajo el árbol. Supongo que fue imposible, que solo fue una ilusión, por su puesto en una conversación lo negaría tajantemente pero hoy... hoy aún podría jurar que aquellas Navidades en que cumplí seis años yo vi a al rey Gaspar entrar en mi habitación y sonreírme.